Transcript: Human XM_005270276.4

PREDICTED: Homo sapiens discs large MAGUK scaffold protein 5 (DLG5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLG5 (9231)
Length:
7437
CDS:
37..5784

Additional Resources:

NCBI RefSeq record:
XM_005270276.4
NBCI Gene record:
DLG5 (9231)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270276.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062729 CCTGGGTTCTTCGAGTAACTT pLKO.1 3804 CDS 100% 5.625 7.875 N DLG5 n/a
2 TRCN0000062730 CCAGGCTCATAACAAACGGAA pLKO.1 2505 CDS 100% 2.640 3.696 N DLG5 n/a
3 TRCN0000062732 GCAGTGTGATACCATCACCAT pLKO.1 4272 CDS 100% 2.640 3.696 N DLG5 n/a
4 TRCN0000062728 GCAGGGTAATTCTTAAACTTT pLKO.1 6648 3UTR 100% 5.625 3.938 N DLG5 n/a
5 TRCN0000062731 GCTCAGCATGTCTGAAGTCAA pLKO.1 5016 CDS 100% 4.950 3.465 N DLG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270276.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489080 GGCACTCATTCGATCTGATTAACT pLX_317 15.6% 35.1% 35.1% V5 (not translated due to prior stop codon) 1_3723del n/a
Download CSV