Transcript: Human XM_005270924.3

PREDICTED: Homo sapiens phosphodiesterase 4B (PDE4B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE4B (5142)
Length:
3546
CDS:
95..1648

Additional Resources:

NCBI RefSeq record:
XM_005270924.3
NBCI Gene record:
PDE4B (5142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048818 GCATAGTTCAAGCCTAAACAA pLKO.1 382 CDS 100% 5.625 7.875 N PDE4B n/a
2 TRCN0000423795 ACTGAACTCACTGACTAATAA pLKO_005 1979 3UTR 100% 15.000 10.500 N PDE4B n/a
3 TRCN0000427257 ATGCATCATGTATGCTATATT pLKO_005 532 CDS 100% 15.000 10.500 N PDE4B n/a
4 TRCN0000434078 ATAACCTACATGATGACTTTA pLKO_005 602 CDS 100% 13.200 9.240 N PDE4B n/a
5 TRCN0000413944 ACCATTCTGACGTGGCATATC pLKO_005 633 CDS 100% 10.800 7.560 N PDE4B n/a
6 TRCN0000114915 CCAGATAAGTGGAGTGAAGAA pLKO.1 355 CDS 100% 4.950 3.465 N Pde4b n/a
7 TRCN0000048822 CCTCCTAAAGACATTCAGAAT pLKO.1 565 CDS 100% 4.950 3.465 N PDE4B n/a
8 TRCN0000048820 CCTTGGAATTGTATCGGCAAT pLKO.1 1149 CDS 100% 4.050 2.835 N PDE4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06703 pDONR223 100% 70.2% 70.2% None 0_1ins657 n/a
2 ccsbBroad304_06703 pLX_304 0% 70.2% 70.2% V5 0_1ins657 n/a
3 TRCN0000477230 ACAAGCGGTCCATTGACATACTCA pLX_317 13.9% 70.2% 70.2% V5 0_1ins657 n/a
Download CSV