Transcript: Human XM_005271604.3

PREDICTED: Homo sapiens tetratricopeptide repeat domain 12 (TTC12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC12 (54970)
Length:
2696
CDS:
322..2655

Additional Resources:

NCBI RefSeq record:
XM_005271604.3
NBCI Gene record:
TTC12 (54970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437599 CAACCGAGCCCAGGCTTATAT pLKO_005 753 CDS 100% 15.000 21.000 N TTC12 n/a
2 TRCN0000412753 TACTAGCTATCTGCACGAATA pLKO_005 2075 CDS 100% 10.800 15.120 N TTC12 n/a
3 TRCN0000152766 GACTGCATCACGTTATGCTAT pLKO.1 2049 CDS 100% 4.950 6.930 N TTC12 n/a
4 TRCN0000158227 CGTGTGCTAGTGATACACCAT pLKO.1 1318 CDS 100% 2.640 3.696 N TTC12 n/a
5 TRCN0000150819 GCATTTGCTGAAGGCAATTAT pLKO.1 667 CDS 100% 15.000 10.500 N TTC12 n/a
6 TRCN0000427231 CAGTGACAACGAGGTCATAAG pLKO_005 1194 CDS 100% 10.800 7.560 N TTC12 n/a
7 TRCN0000158255 CGAGCAGGAGTGGTAAAGAAA pLKO.1 1999 CDS 100% 5.625 3.938 N TTC12 n/a
8 TRCN0000153407 GCAGTTGAAGAAATGGTCTGT pLKO.1 1243 CDS 100% 2.640 1.848 N TTC12 n/a
9 TRCN0000157155 GATGAGGAAACTGAGGTGCAA pLKO.1 2538 CDS 100% 2.640 1.584 N TTC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12125 pDONR223 100% 92.2% 92.1% None (many diffs) n/a
2 ccsbBroad304_12125 pLX_304 0% 92.2% 92.1% V5 (many diffs) n/a
3 TRCN0000472090 AATGTGTTTTGCTAGTGGTTACGA pLX_317 13.9% 92.2% 92.1% V5 (many diffs) n/a
Download CSV