Transcript: Human XM_005271904.4

PREDICTED: Homo sapiens arylsulfatase family member K (ARSK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARSK (153642)
Length:
3344
CDS:
700..1833

Additional Resources:

NCBI RefSeq record:
XM_005271904.4
NBCI Gene record:
ARSK (153642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271904.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371348 ATTCGGATGGTGCATCAATAT pLKO_005 1508 CDS 100% 13.200 18.480 N ARSK n/a
2 TRCN0000163694 GCCATGGAACATCGACAGTTT pLKO.1 1174 CDS 100% 4.950 6.930 N ARSK n/a
3 TRCN0000159542 CATGGTTAATCTTATCCGTAA pLKO.1 699 5UTR 100% 4.050 5.670 N ARSK n/a
4 TRCN0000160092 CGAACACAGAAATTTGGGAAA pLKO.1 535 5UTR 100% 4.050 5.670 N ARSK n/a
5 TRCN0000159473 CAGAAGCTTCATTCCATTATA pLKO.1 1615 CDS 100% 15.000 10.500 N ARSK n/a
6 TRCN0000160512 CTGTAACAGTTATGTTCCTTT pLKO.1 2394 3UTR 100% 4.950 3.465 N ARSK n/a
7 TRCN0000160622 CCAGTATAATAAAGAGCAGTT pLKO.1 1665 CDS 100% 4.050 2.835 N ARSK n/a
8 TRCN0000371347 TTCGATGGAAGGTTAACATTT pLKO_005 295 5UTR 100% 13.200 7.920 N ARSK n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2030 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000163664 GCACACCTATAGTCTCAGCTA pLKO.1 2084 3UTR 100% 2.640 1.320 Y ARSK n/a
11 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2027 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271904.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05075 pDONR223 100% 70.3% 70.3% None 0_1ins477 n/a
2 ccsbBroad304_05075 pLX_304 0% 70.3% 70.3% V5 0_1ins477 n/a
3 TRCN0000474559 GCCTATTCCCTATCATTGCCGGCG pLX_317 22.3% 70.3% 70.3% V5 0_1ins477 n/a
Download CSV