Transcript: Human XM_005272109.5

PREDICTED: Homo sapiens family with sequence similarity 172 member A (FAM172A), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM172A (83989)
Length:
14181
CDS:
180..1157

Additional Resources:

NCBI RefSeq record:
XM_005272109.5
NBCI Gene record:
FAM172A (83989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272109.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127701 GCGACGTGATTTCTATGAGAA pLKO.1 896 CDS 100% 4.950 6.930 N FAM172A n/a
2 TRCN0000146308 CATGCAATCTATGTTTGGGAT pLKO.1 987 CDS 100% 2.640 3.696 N FAM172A n/a
3 TRCN0000147818 GCTTTGACAAATCCACAGAAA pLKO.1 606 CDS 100% 4.950 3.960 N FAM172A n/a
4 TRCN0000352960 GCTTTGACAAATCCACAGAAA pLKO_005 606 CDS 100% 4.950 3.960 N FAM172A n/a
5 TRCN0000150118 CTACCGCACTGAAAGATTTAT pLKO.1 271 CDS 100% 15.000 10.500 N FAM172A n/a
6 TRCN0000147451 GCACACAGATACCGTTTATTA pLKO.1 712 CDS 100% 15.000 10.500 N FAM172A n/a
7 TRCN0000343350 GCACACAGATACCGTTTATTA pLKO_005 712 CDS 100% 15.000 10.500 N FAM172A n/a
8 TRCN0000129368 GCAGTGGGCTAGAAGACTTAT pLKO.1 668 CDS 100% 13.200 9.240 N FAM172A n/a
9 TRCN0000147292 GCTGAAGGATATGGAGTAATA pLKO.1 744 CDS 100% 13.200 9.240 N FAM172A n/a
10 TRCN0000148299 CCTGAAGAACATGCAATCTAT pLKO.1 978 CDS 100% 5.625 3.375 N FAM172A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272109.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04314 pDONR223 100% 75% 74.1% None (many diffs) n/a
2 ccsbBroad304_04314 pLX_304 0% 75% 74.1% V5 (many diffs) n/a
3 TRCN0000479117 CGCCGGTCCCAGCCCATAGAACCT pLX_317 34.4% 75% 74.1% V5 (many diffs) n/a
Download CSV