Transcript: Human XM_005272120.4

PREDICTED: Homo sapiens prolyl 4-hydroxylase subunit alpha 2 (P4HA2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P4HA2 (8974)
Length:
4820
CDS:
350..1957

Additional Resources:

NCBI RefSeq record:
XM_005272120.4
NBCI Gene record:
P4HA2 (8974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061995 CGTCAGGTACTACGATGTCAT pLKO.1 1363 CDS 100% 4.950 6.930 N P4HA2 n/a
2 TRCN0000333734 CGTCAGGTACTACGATGTCAT pLKO_005 1363 CDS 100% 4.950 6.930 N P4HA2 n/a
3 TRCN0000061996 GCCGAATTCTTCACCTCTATT pLKO.1 410 CDS 100% 0.000 0.000 N P4HA2 n/a
4 TRCN0000333732 GCCGAATTCTTCACCTCTATT pLKO_005 410 CDS 100% 0.000 0.000 N P4HA2 n/a
5 TRCN0000061993 CGAGATACTTTCAAGCATTTA pLKO.1 1664 CDS 100% 13.200 9.240 N P4HA2 n/a
6 TRCN0000333735 CGAGATACTTTCAAGCATTTA pLKO_005 1664 CDS 100% 13.200 9.240 N P4HA2 n/a
7 TRCN0000061994 GCGGTACTTTGAGCAGTTATT pLKO.1 1090 CDS 100% 13.200 9.240 N P4HA2 n/a
8 TRCN0000061997 GCAGTCTCTGAAAGAGTACAT pLKO.1 472 CDS 100% 4.950 3.465 N P4HA2 n/a
9 TRCN0000333817 GCAGTCTCTGAAAGAGTACAT pLKO_005 472 CDS 100% 4.950 3.465 N P4HA2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3694 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3562 3UTR 100% 2.640 1.320 Y LINC01098 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3694 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02057 pDONR223 100% 97.5% 97.7% None (many diffs) n/a
2 ccsbBroad304_02057 pLX_304 0% 97.5% 97.7% V5 (many diffs) n/a
3 TRCN0000473272 CCGAGGCGTGAGTGCACACGACAT pLX_317 33% 97.5% 97.7% V5 (many diffs) n/a
4 ccsbBroadEn_11323 pDONR223 100% 92.2% 92.3% None (many diffs) n/a
5 ccsbBroad304_11323 pLX_304 0% 92.2% 92.3% V5 (many diffs) n/a
6 TRCN0000476518 ACGCTTCCGCGATGTGGGGCCGGA pLX_317 29.5% 92.2% 92.3% V5 (many diffs) n/a
Download CSV