Transcript: Human XM_005272616.1

PREDICTED: Homo sapiens BCL6 corepressor (BCOR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCOR (54880)
Length:
6555
CDS:
425..5692

Additional Resources:

NCBI RefSeq record:
XM_005272616.1
NBCI Gene record:
BCOR (54880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244243 ACGTGGGTGACCGATTCAAAT pLKO_005 3339 CDS 100% 13.200 18.480 N BCOR n/a
2 TRCN0000236074 CGCATCAAACCGGATTGTTTA pLKO_005 6279 3UTR 100% 13.200 18.480 N BCOR n/a
3 TRCN0000033459 CCCGCATATTTCGCTGCAATT pLKO.1 5454 CDS 100% 10.800 15.120 N BCOR n/a
4 TRCN0000033461 CCACGAAACTTATACTTTCAA pLKO.1 3019 CDS 100% 5.625 7.875 N BCOR n/a
5 TRCN0000033463 CCCACAGTGAACTTATGGAAA pLKO.1 5133 CDS 100% 4.950 3.960 N BCOR n/a
6 TRCN0000236075 AGCAACCCAGAACCGAGTTTC pLKO_005 2282 CDS 100% 10.800 7.560 N BCOR n/a
7 TRCN0000033460 GCCAAATAAGTATTCACTGAA pLKO.1 1051 CDS 100% 4.950 3.465 N BCOR n/a
8 TRCN0000033462 GCTCTATATTTCTGTCTCCAA pLKO.1 2331 CDS 100% 2.640 1.848 N BCOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12102 pDONR223 100% 10.6% 10.6% None 1_4704del n/a
2 ccsbBroad304_12102 pLX_304 0% 10.6% 10.6% V5 1_4704del n/a
3 TRCN0000472582 ATCCCGCCTCTGCTGCTGACCAGA pLX_317 80.3% 10.6% 10.6% V5 1_4704del n/a
Download CSV