Transcript: Human XM_005272697.2

PREDICTED: Homo sapiens solute carrier family 38 member 5 (SLC38A5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A5 (92745)
Length:
1659
CDS:
104..1600

Additional Resources:

NCBI RefSeq record:
XM_005272697.2
NBCI Gene record:
SLC38A5 (92745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420176 TCCTTGTTTCGGTCATCTACA pLKO_005 744 CDS 100% 4.950 6.930 N SLC38A5 n/a
2 TRCN0000044003 CCGGGATATCTTTGGAGTTAT pLKO.1 1312 CDS 100% 13.200 9.240 N SLC38A5 n/a
3 TRCN0000044006 GCCGGTCCAGTTCATGGATTT pLKO.1 232 CDS 100% 10.800 7.560 N SLC38A5 n/a
4 TRCN0000432327 TGCTATAGGCCACAATGAAAC pLKO_005 784 CDS 100% 10.800 7.560 N SLC38A5 n/a
5 TRCN0000044007 AGCATCTTCTACCTCCGCATT pLKO.1 1373 CDS 100% 4.050 2.835 N SLC38A5 n/a
6 TRCN0000044005 GCTCACAGCAACCTTTGGATA pLKO.1 1039 CDS 100% 4.950 2.970 N SLC38A5 n/a
7 TRCN0000069390 CTGTTCATCATCAAATCTGAA pLKO.1 548 CDS 100% 4.950 3.465 N Slc38a5 n/a
8 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1500 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04590 pDONR223 100% 88.9% 87.1% None (many diffs) n/a
2 ccsbBroad304_04590 pLX_304 0% 88.9% 87.1% V5 (many diffs) n/a
3 TRCN0000474184 CTGGACCATGTTACGACTAACTTT pLX_317 40.1% 88.9% 87.1% V5 (many diffs) n/a
Download CSV