Transcript: Human XM_005273165.4

PREDICTED: Homo sapiens plexin A2 (PLXNA2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNA2 (5362)
Length:
6811
CDS:
375..5846

Additional Resources:

NCBI RefSeq record:
XM_005273165.4
NBCI Gene record:
PLXNA2 (5362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273165.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061500 CGTGTATAAGAATGTGCCCTA pLKO.1 5024 CDS 100% 2.160 3.024 N PLXNA2 n/a
2 TRCN0000360047 AGATTCTTGATGCCGTGTATA pLKO_005 5011 CDS 100% 13.200 9.240 N PLXNA2 n/a
3 TRCN0000360049 GATCCCAGTGAAGGTGTTAAA pLKO_005 4961 CDS 100% 13.200 9.240 N PLXNA2 n/a
4 TRCN0000359992 GGCCATCAACCGGGTCTATAA pLKO_005 614 CDS 100% 13.200 9.240 N PLXNA2 n/a
5 TRCN0000359988 TGTGGTGTGGAACGGCAATTT pLKO_005 2765 CDS 100% 13.200 9.240 N PLXNA2 n/a
6 TRCN0000061501 CGCCCAGATGAGTTTGGATTT pLKO.1 3762 CDS 100% 10.800 7.560 N PLXNA2 n/a
7 TRCN0000061502 CCACTTTGACATCTTCTACAT pLKO.1 1130 CDS 100% 4.950 3.465 N PLXNA2 n/a
8 TRCN0000061499 CGGCAATTTCATCATTGACAA pLKO.1 2777 CDS 100% 4.950 3.465 N PLXNA2 n/a
9 TRCN0000061498 CCCATCATTCTGAAGGGCAAA pLKO.1 3900 CDS 100% 4.050 2.835 N PLXNA2 n/a
10 TRCN0000078965 CCAGCCACAATGTCAAGTGTT pLKO.1 2965 CDS 100% 4.950 2.970 N Plxna2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273165.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13921 pDONR223 100% 88.1% 45.9% None (many diffs) n/a
2 ccsbBroad304_13921 pLX_304 0% 88.1% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480657 GTTCGGCTGCCTTTGCTGGACGTC pLX_317 6.9% 88.1% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV