Transcript: Human XM_005273468.1

PREDICTED: Homo sapiens ADAM metallopeptidase domain 2 (ADAM2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM2 (2515)
Length:
2520
CDS:
43..2160

Additional Resources:

NCBI RefSeq record:
XM_005273468.1
NBCI Gene record:
ADAM2 (2515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006814 CCAGAACCATAAGTCTGGAAT pLKO.1 938 CDS 100% 0.495 0.693 N ADAM2 n/a
2 TRCN0000006813 GCTTCATATTTACCTCCAGAT pLKO.1 1861 CDS 100% 4.050 3.240 N ADAM2 n/a
3 TRCN0000367485 GCTGCGGATGGACAGTAATTT pLKO_005 81 CDS 100% 15.000 10.500 N ADAM2 n/a
4 TRCN0000356067 TGCCACTACCAAGGGTATATT pLKO_005 316 CDS 100% 15.000 10.500 N ADAM2 n/a
5 TRCN0000006815 GCGCTACATTGAGAACATTTA pLKO.1 1971 CDS 100% 13.200 9.240 N ADAM2 n/a
6 TRCN0000356090 TCAGTGGTGTGAAGATCTTTA pLKO_005 1076 CDS 100% 13.200 9.240 N ADAM2 n/a
7 TRCN0000006812 CCTGGGATTCAAACCTGCATA pLKO.1 2263 3UTR 100% 4.950 3.465 N ADAM2 n/a
8 TRCN0000006816 GCATTATGAATCCAGAAGCAA pLKO.1 1049 CDS 100% 3.000 2.100 N ADAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10828 pDONR223 100% 93.3% 93.3% None 513_569del;1613_1614ins90 n/a
2 ccsbBroad304_10828 pLX_304 0% 93.3% 93.3% V5 513_569del;1613_1614ins90 n/a
3 TRCN0000481057 AACTGATTTAAATTTTCTAGAGTT pLX_317 19.1% 93.3% 93.3% V5 513_569del;1613_1614ins90 n/a
4 ccsbBroadEn_10829 pDONR223 100% 82.1% 82.1% None 513_890del n/a
5 ccsbBroad304_10829 pLX_304 0% 82.1% 82.1% V5 513_890del n/a
6 TRCN0000471733 ACATAGGACCCATATCGGGTGGCG pLX_317 22.3% 82.1% 82.1% V5 513_890del n/a
Download CSV