Transcript: Human XM_005273655.5

PREDICTED: Homo sapiens stathmin 4 (STMN4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STMN4 (81551)
Length:
2279
CDS:
133..663

Additional Resources:

NCBI RefSeq record:
XM_005273655.5
NBCI Gene record:
STMN4 (81551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273655.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160451 CTGAATAAGTCGTCCTACAAA pLKO.1 214 CDS 100% 5.625 7.875 N STMN4 n/a
2 TRCN0000162711 CATTTCCGACATGGAAGTCAT pLKO.1 270 CDS 100% 4.950 6.930 N STMN4 n/a
3 TRCN0000164407 CTAGCAGAGAAACGGGAACAT pLKO.1 478 CDS 100% 4.950 3.960 N STMN4 n/a
4 TRCN0000160910 GAAGTCATCGAGCTGAACAAA pLKO.1 283 CDS 100% 5.625 3.938 N STMN4 n/a
5 TRCN0000160167 CAACTTCATCAAGATGGCTAA pLKO.1 537 CDS 100% 4.050 2.835 N STMN4 n/a
6 TRCN0000164435 CCCAGAAGATGGAATCCAACA pLKO.1 569 CDS 100% 4.050 2.835 N STMN4 n/a
7 TRCN0000163346 GCCAAAGAACTTTCCAGGTCA pLKO.1 766 3UTR 100% 2.640 1.848 N STMN4 n/a
8 TRCN0000163179 GACCAGTGAAGCCATCCTATT pLKO.1 921 3UTR 100% 10.800 6.480 N STMN4 n/a
9 TRCN0000163424 GAGAGGAGAGAGTTTGGGAAA pLKO.1 976 3UTR 100% 4.050 2.430 N STMN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273655.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04236 pDONR223 100% 80.5% 79.1% None (many diffs) n/a
2 ccsbBroad304_04236 pLX_304 0% 80.5% 79.1% V5 (many diffs) n/a
3 TRCN0000472188 TTGCTGTTCCCCCGCACCTGTGTG pLX_317 58.6% 80.5% 79.1% V5 (many diffs) n/a
Download CSV