Transcript: Human XM_005273762.3

PREDICTED: Homo sapiens carnitine palmitoyltransferase 1A (CPT1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPT1A (1374)
Length:
5227
CDS:
51..2468

Additional Resources:

NCBI RefSeq record:
XM_005273762.3
NBCI Gene record:
CPT1A (1374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036283 GACAACGATGTACGCCAAGAT pLKO.1 356 CDS 100% 4.950 6.930 N CPT1A n/a
2 TRCN0000036282 CGATGTTACGACAGGTGGTTT pLKO.1 1485 CDS 100% 4.950 3.465 N CPT1A n/a
3 TRCN0000036281 CGTAGCCTTTGGTAAAGGAAT pLKO.1 1799 CDS 100% 4.950 3.465 N CPT1A n/a
4 TRCN0000036279 GCCATGAAGCTCTTAGACAAA pLKO.1 217 CDS 100% 4.950 3.465 N CPT1A n/a
5 TRCN0000110548 GCAACTATTATGCCATGGATT pLKO.1 901 CDS 100% 4.950 2.970 N Cpt1b n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4238 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4238 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00359 pDONR223 100% 93.3% 91.6% None (many diffs) n/a
2 ccsbBroad304_00359 pLX_304 0% 93.3% 91.6% V5 (many diffs) n/a
3 TRCN0000466447 ATGTGTTTGCCGCACGCTGACCGC pLX_317 19% 93.3% 91.6% V5 (many diffs) n/a
Download CSV