Transcript: Human XM_005273763.1

PREDICTED: Homo sapiens carnitine palmitoyltransferase 1A (CPT1A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPT1A (1374)
Length:
2613
CDS:
51..2417

Additional Resources:

NCBI RefSeq record:
XM_005273763.1
NBCI Gene record:
CPT1A (1374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036283 GACAACGATGTACGCCAAGAT pLKO.1 356 CDS 100% 4.950 6.930 N CPT1A n/a
2 TRCN0000036282 CGATGTTACGACAGGTGGTTT pLKO.1 1485 CDS 100% 4.950 3.465 N CPT1A n/a
3 TRCN0000036281 CGTAGCCTTTGGTAAAGGAAT pLKO.1 1799 CDS 100% 4.950 3.465 N CPT1A n/a
4 TRCN0000036279 GCCATGAAGCTCTTAGACAAA pLKO.1 217 CDS 100% 4.950 3.465 N CPT1A n/a
5 TRCN0000110548 GCAACTATTATGCCATGGATT pLKO.1 901 CDS 100% 4.950 2.970 N Cpt1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00359 pDONR223 100% 95.8% 95.9% None 1_96del;1347T>C n/a
2 ccsbBroad304_00359 pLX_304 0% 95.8% 95.9% V5 1_96del;1347T>C n/a
3 TRCN0000466447 ATGTGTTTGCCGCACGCTGACCGC pLX_317 19% 95.8% 95.9% V5 1_96del;1347T>C n/a
Download CSV