Transcript: Human XM_005273974.2

PREDICTED: Homo sapiens immunoglobulin mu DNA binding protein 2 (IGHMBP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGHMBP2 (3508)
Length:
3918
CDS:
1078..3048

Additional Resources:

NCBI RefSeq record:
XM_005273974.2
NBCI Gene record:
IGHMBP2 (3508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019160 CCTTTGAGTATCTTGACGATA pLKO.1 1982 CDS 100% 4.950 6.930 N IGHMBP2 n/a
2 TRCN0000369547 AGCTGTGAAACAAGGCTTAAA pLKO_005 756 5UTR 100% 13.200 9.240 N IGHMBP2 n/a
3 TRCN0000364795 GAAGACCCTGGTGGAGTATTT pLKO_005 1935 CDS 100% 13.200 9.240 N IGHMBP2 n/a
4 TRCN0000369612 GGTTCCAGTCCCTGGAGAATA pLKO_005 3348 3UTR 100% 13.200 9.240 N IGHMBP2 n/a
5 TRCN0000369545 CGACTGTGGTTGAGATCATTC pLKO_005 731 5UTR 100% 10.800 7.560 N IGHMBP2 n/a
6 TRCN0000364727 TGCTCTAAAGAAGTATCATTC pLKO_005 525 5UTR 100% 10.800 7.560 N IGHMBP2 n/a
7 TRCN0000364794 TTTGATGAGTCCCACGATTTC pLKO_005 418 5UTR 100% 10.800 7.560 N IGHMBP2 n/a
8 TRCN0000019161 CCTTTGATGAGTCCCACGATT pLKO.1 416 5UTR 100% 4.950 3.465 N IGHMBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06433 pDONR223 100% 65.9% 65.9% None 0_1ins1011;1000A>G;1305C>T n/a
2 ccsbBroad304_06433 pLX_304 0% 65.9% 65.9% V5 0_1ins1011;1000A>G;1305C>T n/a
3 TRCN0000475908 GCCCGTTTAGAATTCAGGCAAGCG pLX_317 10% 65.9% 65.9% V5 0_1ins1011;1000A>G;1305C>T n/a
Download CSV