Transcript: Human XM_005273975.3

PREDICTED: Homo sapiens immunoglobulin mu DNA binding protein 2 (IGHMBP2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGHMBP2 (3508)
Length:
3049
CDS:
326..2179

Additional Resources:

NCBI RefSeq record:
XM_005273975.3
NBCI Gene record:
IGHMBP2 (3508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019160 CCTTTGAGTATCTTGACGATA pLKO.1 1113 CDS 100% 4.950 6.930 N IGHMBP2 n/a
2 TRCN0000364795 GAAGACCCTGGTGGAGTATTT pLKO_005 1066 CDS 100% 13.200 9.240 N IGHMBP2 n/a
3 TRCN0000369612 GGTTCCAGTCCCTGGAGAATA pLKO_005 2479 3UTR 100% 13.200 9.240 N IGHMBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06433 pDONR223 100% 61% 58% None (many diffs) n/a
2 ccsbBroad304_06433 pLX_304 0% 61% 58% V5 (many diffs) n/a
3 TRCN0000475908 GCCCGTTTAGAATTCAGGCAAGCG pLX_317 10% 61% 58% V5 (many diffs) n/a
Download CSV