Transcript: Human XM_005274184.1

PREDICTED: Homo sapiens kinesin light chain 2 (KLC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLC2 (64837)
Length:
2655
CDS:
181..1983

Additional Resources:

NCBI RefSeq record:
XM_005274184.1
NBCI Gene record:
KLC2 (64837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155851 CAGATCCGCAAGTTGGATGAA pLKO.1 604 CDS 100% 4.950 6.930 N KLC2 n/a
2 TRCN0000153639 CTATCGGGATCAGAACAAGTA pLKO.1 927 CDS 100% 4.950 6.930 N KLC2 n/a
3 TRCN0000155828 CGCGCTCATGAGAAAGAGTTT pLKO.1 1363 CDS 100% 4.950 3.960 N KLC2 n/a
4 TRCN0000423945 AGCCGTGGCTGCGACACTAAA pLKO_005 1017 CDS 100% 4.400 3.520 N KLC2 n/a
5 TRCN0000438474 CCCAGAGCCAAGAACACTAAG pLKO_005 2051 3UTR 100% 10.800 7.560 N KLC2 n/a
6 TRCN0000155929 CAGTTCCCTCAACTTCCTCAA pLKO.1 1920 CDS 100% 4.050 2.835 N KLC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03974 pDONR223 100% 96.3% 95.8% None (many diffs) n/a
2 ccsbBroad304_03974 pLX_304 0% 96.3% 95.8% V5 (many diffs) n/a
3 TRCN0000471275 GCCATTATGTATGACAGACTGTAC pLX_317 12.8% 96.3% 95.8% V5 (many diffs) n/a
Download CSV