Transcript: Human XM_005274501.4

PREDICTED: Homo sapiens anosmin 1 (ANOS1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANOS1 (3730)
Length:
1710
CDS:
97..1359

Additional Resources:

NCBI RefSeq record:
XM_005274501.4
NBCI Gene record:
ANOS1 (3730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274501.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423767 AGGTTAAGTGGTCCTCGAAAT pLKO_005 698 CDS 100% 10.800 15.120 N ANOS1 n/a
2 TRCN0000073674 CGAGTTCAACTGACTGACATA pLKO.1 835 CDS 100% 4.950 3.465 N ANOS1 n/a
3 TRCN0000073676 CTGTGATCTATGTGGTACAAA pLKO.1 737 CDS 100% 5.625 3.375 N ANOS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274501.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06467 pDONR223 100% 60.8% 58.9% None (many diffs) n/a
2 ccsbBroad304_06467 pLX_304 0% 60.8% 58.9% V5 (many diffs) n/a
3 TRCN0000475708 TAGCTGTTACGCTGACAGCTCGAT pLX_317 9.9% 60.8% 58.9% V5 (many diffs) n/a
Download CSV