Transcript: Mouse XM_006495554.2

PREDICTED: Mus musculus regulator of G-protein signaling 20 (Rgs20), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs20 (58175)
Length:
1413
CDS:
57..512

Additional Resources:

NCBI RefSeq record:
XM_006495554.2
NBCI Gene record:
Rgs20 (58175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436652 AGAAAGCAAGGATAATCTATG pLKO_005 271 CDS 100% 10.800 8.640 N RGS20 n/a
2 TRCN0000037180 GCTTACGTCCTTAGCTGAGAA pLKO.1 476 CDS 100% 4.950 3.960 N Rgs20 n/a
3 TRCN0000037183 CTCCACAGTCTATAAGGATTT pLKO.1 455 CDS 100% 10.800 7.560 N Rgs20 n/a
4 TRCN0000037181 CCATCCCAGCACATATTCGAT pLKO.1 375 CDS 100% 3.000 2.100 N Rgs20 n/a
5 TRCN0000037179 CGAACAGAATTCAGTGAAGAA pLKO.1 186 CDS 100% 0.000 0.000 N Rgs20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11282 pDONR223 100% 58.1% 59.9% None (many diffs) n/a
2 ccsbBroad304_11282 pLX_304 0% 58.1% 59.9% V5 (many diffs) n/a
3 TRCN0000474168 AATTTGACGACATGACATTACAAC pLX_317 78.8% 58.1% 59.9% V5 (many diffs) n/a
4 ccsbBroadEn_01965 pDONR223 100% 52.3% 53.9% None (many diffs) n/a
5 ccsbBroad304_01965 pLX_304 0% 52.3% 53.9% V5 (many diffs) n/a
Download CSV