Transcript: Mouse XM_006495594.4

PREDICTED: Mus musculus cysteine-rich secretory protein LCCL domain containing 1 (Crispld1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Crispld1 (83691)
Length:
3732
CDS:
436..1635

Additional Resources:

NCBI RefSeq record:
XM_006495594.4
NBCI Gene record:
Crispld1 (83691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495594.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106325 CCACTGATGAAGTATATCTAA pLKO.1 1946 3UTR 100% 5.625 7.875 N Crispld1 n/a
2 TRCN0000106327 GCCATCCACTATGGGATAATA pLKO.1 1150 CDS 100% 15.000 12.000 N Crispld1 n/a
3 TRCN0000106326 CGAAACTGTATGCAGTCAAAT pLKO.1 1390 CDS 100% 13.200 10.560 N Crispld1 n/a
4 TRCN0000106329 GCCCTCCATTGGACAGAATTT pLKO.1 471 CDS 100% 13.200 9.240 N Crispld1 n/a
5 TRCN0000106328 CCAACAGAAATGGCATTCAAA pLKO.1 1232 CDS 100% 5.625 3.938 N Crispld1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495594.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09106 pDONR223 100% 70.4% 76% None (many diffs) n/a
2 ccsbBroad304_09106 pLX_304 0% 70.4% 76% V5 (many diffs) n/a
3 TRCN0000473764 TCCTAACCGCTTGGCTGCGCGCGG pLX_317 37.5% 70.4% 76% V5 (many diffs) n/a
Download CSV