Transcript: Mouse XM_006495749.4

PREDICTED: Mus musculus microtubule-associated protein 2 (Map2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Map2 (17756)
Length:
15316
CDS:
6161..11740

Additional Resources:

NCBI RefSeq record:
XM_006495749.4
NBCI Gene record:
Map2 (17756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089689 GCAGTTAGAAACTATTCCTAA pLKO.1 10381 CDS 100% 4.950 6.930 N Map2 n/a
2 TRCN0000089692 CCTAAGCAGCTTCGGCTTATT pLKO.1 11132 CDS 100% 1.320 1.848 N Map2 n/a
3 TRCN0000437997 GTGCCTGAAGGCTATCCAATA pLKO_005 12038 3UTR 100% 10.800 8.640 N Map2 n/a
4 TRCN0000089690 CCCAGGAATCTCTTGATACTA pLKO.1 7959 CDS 100% 5.625 4.500 N Map2 n/a
5 TRCN0000420961 TGGATACAATCGGACAATTAT pLKO_005 11951 3UTR 100% 15.000 10.500 N Map2 n/a
6 TRCN0000416565 GATCAACTGACAACATCAAAT pLKO_005 11196 CDS 100% 13.200 9.240 N Map2 n/a
7 TRCN0000432751 ACAGGTCACAGGGCACCTATT pLKO_005 6342 CDS 100% 10.800 7.560 N Map2 n/a
8 TRCN0000089688 CCTTTAGCACTGGAGTAACAT pLKO.1 11749 3UTR 100% 5.625 3.938 N Map2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3776 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06559 pDONR223 100% 24.1% 26.8% None (many diffs) n/a
2 ccsbBroad304_06559 pLX_304 0% 24.1% 26.8% V5 (many diffs) n/a
3 TRCN0000478641 CGCTTCTGCGATGCTCAGGACAGG pLX_317 23% 24.1% 26.8% V5 (many diffs) n/a
Download CSV