Transcript: Mouse XM_006496066.3

PREDICTED: Mus musculus HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (Hecw2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hecw2 (329152)
Length:
11654
CDS:
568..5304

Additional Resources:

NCBI RefSeq record:
XM_006496066.3
NBCI Gene record:
Hecw2 (329152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092592 CCTCTATACATGAAACTGCAT pLKO.1 2120 CDS 100% 2.640 3.696 N Hecw2 n/a
2 TRCN0000092589 GCGATCTAACTCCATACAGCA pLKO.1 3129 CDS 100% 2.640 2.112 N Hecw2 n/a
3 TRCN0000092590 GATTCCCTCAATGATTACTTA pLKO.1 1804 CDS 100% 5.625 3.938 N Hecw2 n/a
4 TRCN0000092588 GACGAAGAAGACCATGAGTTT pLKO.1 1960 CDS 100% 4.950 3.465 N Hecw2 n/a
5 TRCN0000086875 GCAGGAGAGAAGGTCCACTAT pLKO.1 1251 CDS 100% 4.950 3.465 N Hecw2 n/a
6 TRCN0000086876 CCTCATTATCTTCTGGGACAT pLKO.1 792 CDS 100% 4.050 2.835 N Hecw2 n/a
7 TRCN0000086877 CTACTTCATGGAACCGGAGAT pLKO.1 954 CDS 100% 4.050 2.835 N Hecw2 n/a
8 TRCN0000086874 GTTCTTCAATCCTGACCCTTA pLKO.1 1170 CDS 100% 4.050 2.835 N Hecw2 n/a
9 TRCN0000086873 GCTCAAGAAAGGGATGTTCTT pLKO.1 1155 CDS 100% 0.495 0.347 N Hecw2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.