Transcript: Mouse XM_006496073.3

PREDICTED: Mus musculus ankyrin repeat domain 44 (Ankrd44), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd44 (329154)
Length:
6346
CDS:
562..3597

Additional Resources:

NCBI RefSeq record:
XM_006496073.3
NBCI Gene record:
Ankrd44 (329154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249193 ACGTAGATGCGGTCGACATAG pLKO_005 2699 CDS 100% 10.800 15.120 N Ankrd44 n/a
2 TRCN0000249196 CACATGGAGATGGTCAATTTA pLKO_005 1015 CDS 100% 15.000 10.500 N Ankrd44 n/a
3 TRCN0000249195 ACCACCGGAGCCAACGTTAAT pLKO_005 1990 CDS 100% 13.200 9.240 N Ankrd44 n/a
4 TRCN0000249197 ATTGCCTAAAGTCCTAGTAAA pLKO_005 5531 3UTR 100% 13.200 9.240 N Ankrd44 n/a
5 TRCN0000249194 TTTGTCAGGAGCTCGTGTAAA pLKO_005 744 CDS 100% 13.200 7.920 N Ankrd44 n/a
6 TRCN0000147456 GAGATCATTGAACTCCTGATT pLKO.1 724 CDS 100% 4.950 2.970 N ANKRD44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12961 pDONR223 100% 50.8% 53.6% None (many diffs) n/a
2 ccsbBroad304_12961 pLX_304 0% 50.8% 53.6% V5 (many diffs) n/a
3 TRCN0000474029 TACACCACAGTACGAAATTGCAGA pLX_317 27.3% 50.8% 53.6% V5 (many diffs) n/a
4 ccsbBroadEn_04548 pDONR223 100% 32.6% 35.6% None (many diffs) n/a
5 ccsbBroad304_04548 pLX_304 0% 32.6% 35.6% V5 (many diffs) n/a
6 TRCN0000466077 GGCCGACCGACTCGATATCAATGA pLX_317 33.3% 32.6% 35.6% V5 (many diffs) n/a
Download CSV