Transcript: Mouse XM_006496391.3

PREDICTED: Mus musculus protein transport protein Sec61 subunit gamma (LOC102637269), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC102637269 (102637269)
Length:
261
CDS:
16..222

Additional Resources:

NCBI RefSeq record:
XM_006496391.3
NBCI Gene record:
LOC102637269 (102637269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100517 ACTGATCCATATACCCATTAA pLKO.1 180 CDS 100% 13.200 6.600 Y Sec61g n/a
2 TRCN0000334191 ACTGATCCATATACCCATTAA pLKO_005 180 CDS 100% 13.200 6.600 Y Sec61g n/a
3 TRCN0000100519 AGGACTCAATTCGGCTGGTTA pLKO.1 62 CDS 100% 4.950 2.475 Y Sec61g n/a
4 TRCN0000334190 AGGACTCAATTCGGCTGGTTA pLKO_005 62 CDS 100% 4.950 2.475 Y Sec61g n/a
5 TRCN0000100518 CATGGGATTCATTGGCTTCTT pLKO.1 153 CDS 100% 4.950 2.475 Y Sec61g n/a
6 TRCN0000334257 CATGGGATTCATTGGCTTCTT pLKO_005 153 CDS 100% 4.950 2.475 Y Sec61g n/a
7 TRCN0000381569 GATGCACCAAACCCGACAGAA pLKO_005 86 CDS 100% 4.950 2.475 Y Sec61g n/a
8 TRCN0000100516 GCAGTTTGTAAAGGACTCAAT pLKO.1 51 CDS 100% 4.950 2.475 Y Sec61g n/a
9 TRCN0000273514 ATTCCAGAAGATTGCCATGGC pLKO_005 111 CDS 100% 2.160 1.080 Y SEC61G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02776 pDONR223 100% 92.6% 100% None (many diffs) n/a
2 ccsbBroad304_02776 pLX_304 0% 92.6% 100% V5 (many diffs) n/a
3 TRCN0000466863 AATTTTGGCGTTCCAACTTCGCGC pLX_317 100% 92.6% 100% V5 (many diffs) n/a
Download CSV