Transcript: Mouse XM_006496620.3

PREDICTED: Mus musculus v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) (Abl2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abl2 (11352)
Length:
11082
CDS:
1042..4230

Additional Resources:

NCBI RefSeq record:
XM_006496620.3
NBCI Gene record:
Abl2 (11352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023346 CCTAATCTCTTTGTTGCACTT pLKO.1 1321 CDS 100% 4.050 5.670 N Abl2 n/a
2 TRCN0000360614 GATTAGGGAGCCTCGTGTATA pLKO_005 4480 3UTR 100% 13.200 10.560 N Abl2 n/a
3 TRCN0000023347 CGTGTCTCCTATCCATGACAA pLKO.1 1815 CDS 100% 4.950 3.960 N Abl2 n/a
4 TRCN0000360685 CCGAGAGTCTGGCCTACAATA pLKO_005 2357 CDS 100% 13.200 9.240 N Abl2 n/a
5 TRCN0000199548 CCACTGAGAGTGACCCTAATC pLKO.1 1307 CDS 100% 10.800 7.560 N ABL2 n/a
6 TRCN0000023345 CCAGGTATTGACCTATCTCAA pLKO.1 2455 CDS 100% 4.950 3.465 N Abl2 n/a
7 TRCN0000023348 GATGCCAAAGAGACATGCTTT pLKO.1 2908 CDS 100% 4.950 3.465 N Abl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489907 GGCAATTTCACTGAGGTCCCTCAT pLX_317 11.6% 81.4% 85.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14526 pDONR223 0% 79.8% 83.7% None (many diffs) n/a
3 ccsbBroad304_14526 pLX_304 0% 79.8% 83.7% V5 (many diffs) n/a
4 TRCN0000471114 CACTAGGCCAACTGCGTGAGATAA pLX_317 10.1% 79.8% 83.7% V5 (many diffs) n/a
Download CSV