Transcript: Mouse XM_006496700.2

PREDICTED: Mus musculus pre B cell leukemia homeobox 1 (Pbx1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pbx1 (18514)
Length:
3444
CDS:
761..1981

Additional Resources:

NCBI RefSeq record:
XM_006496700.2
NBCI Gene record:
Pbx1 (18514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321052 TCAAGAGGAAGCCAATATTTA pLKO_005 1654 CDS 100% 15.000 10.500 N Pbx1 n/a
2 TRCN0000240254 TTCAAGAGGAAGCCAATATTT pLKO_005 1653 CDS 100% 15.000 10.500 N LOC676870 n/a
3 TRCN0000274085 TTCAAGAGGAAGCCAATATTT pLKO_005 1653 CDS 100% 15.000 10.500 N PBX1 n/a
4 TRCN0000320980 TTTACTGTGTACCACAATATA pLKO_005 2257 3UTR 100% 15.000 10.500 N Pbx1 n/a
5 TRCN0000320979 ACTCTCACAGATCAGACAAAT pLKO_005 1219 CDS 100% 13.200 9.240 N Pbx1 n/a
6 TRCN0000350558 AGGCGGAAGAGACGGAATTTC pLKO_005 1460 CDS 100% 13.200 9.240 N Pbx1 n/a
7 TRCN0000020393 CATGTCAAACTCTGGAGATTT pLKO.1 1777 CDS 100% 13.200 9.240 N PBX1 n/a
8 TRCN0000274138 CATGTCAAACTCTGGAGATTT pLKO_005 1777 CDS 100% 13.200 9.240 N PBX1 n/a
9 TRCN0000240255 GAGGCGGAAGAGACGGAATTT pLKO_005 1459 CDS 100% 13.200 9.240 N LOC676870 n/a
10 TRCN0000240257 GGATACCCTTCGCCATGTTAT pLKO_005 1873 CDS 100% 13.200 9.240 N LOC676870 n/a
11 TRCN0000240256 ACAGTCTCCCAGGTATCAAAC pLKO_005 1586 CDS 100% 10.800 7.560 N LOC676870 n/a
12 TRCN0000012577 CTCACAGATCAGACAAATCTA pLKO.1 1222 CDS 100% 5.625 3.938 N Pbx1 n/a
13 TRCN0000012576 GCGGAAGAGACGGAATTTCAA pLKO.1 1462 CDS 100% 5.625 3.938 N Pbx1 n/a
14 TRCN0000012573 GCCCATTGATTGGTTTGGAAA pLKO.1 2744 3UTR 100% 4.950 3.465 N Pbx1 n/a
15 TRCN0000012575 GCCTGCCTTGTTTAATGTGTT pLKO.1 982 CDS 100% 4.950 3.465 N Pbx1 n/a
16 TRCN0000321049 GCCTGCCTTGTTTAATGTGTT pLKO_005 982 CDS 100% 4.950 3.465 N Pbx1 n/a
17 TRCN0000012574 GCCAATATTTATGCTGCCAAA pLKO.1 1664 CDS 100% 4.050 2.835 N Pbx1 n/a
18 TRCN0000020390 GCCTTGTTTAATGTGTTGTGT pLKO.1 986 CDS 100% 3.000 2.100 N PBX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.