Transcript: Mouse XM_006496722.2

PREDICTED: Mus musculus transmembrane protein 63a (Tmem63a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem63a (208795)
Length:
3284
CDS:
102..2516

Additional Resources:

NCBI RefSeq record:
XM_006496722.2
NBCI Gene record:
Tmem63a (208795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304794 ACGTCCCAATGACTCCTATTG pLKO_005 176 CDS 100% 10.800 15.120 N Tmem63a n/a
2 TRCN0000304851 CCGAGAAGAGCCTTACCTATT pLKO_005 934 CDS 100% 10.800 8.640 N Tmem63a n/a
3 TRCN0000126436 GCTAGTGACAAAGGAAGCGAA pLKO.1 2298 CDS 100% 2.640 2.112 N Tmem63a n/a
4 TRCN0000349169 GCTAGTGACAAAGGAAGCGAA pLKO_005 2298 CDS 100% 2.640 2.112 N Tmem63a n/a
5 TRCN0000304852 GCCTTTAGGGAGATCATATTT pLKO_005 2886 3UTR 100% 15.000 10.500 N Tmem63a n/a
6 TRCN0000126434 CCGTATTGTGAGAAGAGGAAA pLKO.1 2622 3UTR 100% 4.950 3.465 N Tmem63a n/a
7 TRCN0000126435 CCTCTATACCTTCCGCATGAT pLKO.1 1835 CDS 100% 4.950 3.465 N Tmem63a n/a
8 TRCN0000316315 CCTCTATACCTTCCGCATGAT pLKO_005 1835 CDS 100% 4.950 3.465 N Tmem63a n/a
9 TRCN0000126437 CTCTTAGATGTCAGTTGCTTT pLKO.1 264 CDS 100% 4.950 3.465 N Tmem63a n/a
10 TRCN0000126438 CTGTTTCTAATCCTGGTGTTT pLKO.1 285 CDS 100% 4.950 3.465 N Tmem63a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02232 pDONR223 100% 87.2% 89.7% None (many diffs) n/a
2 ccsbBroad304_02232 pLX_304 0% 87.2% 89.7% V5 (many diffs) n/a
3 TRCN0000472089 CCCTAGCCAGCCTCGAGAGCTGGG pLX_317 15.3% 87.2% 89.7% V5 (many diffs) n/a
Download CSV