Construct: ORF TRCN0000472089
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014948.1_s317c1
- Derived from:
- ccsbBroadEn_02232
- DNA Barcode:
- CCCTAGCCAGCCTCGAGAGCTGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM63A (9725)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472089
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9725 | TMEM63A | transmembrane protein 63A | NM_014698.3 | 100% | 100% | |
| 2 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_011544328.3 | 100% | 100% | |
| 3 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_011544329.3 | 100% | 100% | |
| 4 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_011544330.3 | 100% | 100% | |
| 5 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_011544331.3 | 96.4% | 96.2% | 1484_1485ins87 |
| 6 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_011544332.3 | 81.7% | 77.8% | 0_1ins389;125_126ins52 |
| 7 | human | 9725 | TMEM63A | transmembrane protein 63A | XM_006711841.4 | 78% | 72.8% | 0_1ins370;143_144ins161 |
| 8 | human | 9725 | TMEM63A | transmembrane protein 63A | XR_949163.3 | 70.3% | 1_284del;2706_3441del | |
| 9 | human | 9725 | TMEM63A | transmembrane protein 63A | XR_001737552.2 | 54.2% | 1_281del;1658_1659ins194;2509_3911del | |
| 10 | mouse | 208795 | Tmem63a | transmembrane protein 63a | NM_144794.2 | 87.2% | 89.7% | (many diffs) |
| 11 | mouse | 208795 | Tmem63a | transmembrane protein 63a | XM_006496721.3 | 87.2% | 89.7% | (many diffs) |
| 12 | mouse | 208795 | Tmem63a | transmembrane protein 63a | XM_006496722.2 | 87.2% | 89.7% | (many diffs) |
| 13 | mouse | 208795 | Tmem63a | transmembrane protein 63a | XM_006496723.3 | 87.2% | 89.7% | (many diffs) |
| 14 | mouse | 208795 | Tmem63a | transmembrane protein 63a | XR_001783670.1 | 64.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2487
- ORF length:
- 2421
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggactccccg ttcctggagc tgtggcagtc caaggcagtg tccatcaggg 121 agcagctggg actcggggac cggcccaacg actcctattg ctacaactcg gccaaaaaca 181 gcaccgtgct ccagggggtc acctttggtg gcatccccac tgtcctgctc atagacgtca 241 gctgcttcct gttcttaatc ttggtgtttt ctattataag aagaagattc tgggactatg 301 gccgcattgc cctggtgtca gaagcagaca gcgagtccag atttcagaga ttgtcatcga 361 cttcctcctc aggtcaacaa gactttgaaa atgagctggg atgctgtccc tggctgactg 421 ccatcttccg tctgcatgat gaccagatcc tggaatggtg tggggaggac gccatccact 481 acctgtcctt ccagaggcac atcatcttcc tgttggtggt ggtcagcttt ttgtccctgt 541 gtgtcatcct gcctgtcaac ctctcagggg acttgctgga caaagacccg tatagttttg 601 ggaggacaac aatagcaaac ctacagactg acaatgacct cctttggctg cacaccatct 661 ttgctgtcat ttacctcttc ctcactgtgg gtttcatgcg gcaccacact cagtccatta 721 agtacaaaga ggagaacctg gtgaggcgga ccctgttcat cacaggactc cccagagatg 781 ccaggaagga gactgtggag agccacttcc gggacgcgta tcccacgtgt gaggtggttg 841 atgtgcagct gtgctacaac gtggccaaac tgatctacct gtgcaaggag aaaaagaaga 901 ctgagaagag cctgacctat tacacaaacc tgcaggtgaa gacaggccag cggaccctca 961 tcaaccccaa gccctgtggc cagttttgct gctgtgaagt gctgggctgt gagtgggaag 1021 acgccatctc ttactacaca cggatgaagg acaggctgct ggagaggatc acagaggaag 1081 aacgccacgt ccaggaccag cccctgggaa tggccttcgt caccttccag gagaagtcca 1141 tggccaccta catcctgaaa gatttcaatg cctgcaagtg tcagagcctt cagtgcaaag 1201 gtgagcccca gccgtcctcc catagcaggg agctctatac ctccaagtgg acagtcacct 1261 ttgctgctga ccctgaggac atctgctgga agaacctctc tatccagggc ctccgctggt 1321 ggctacagtg gctgggcatc aacttcaccc tcttcctggg gctatttttc ctgaccacac 1381 cctccatcat cctgtccacc atggacaagt ttaatgtcac caaacccatc catgcgctga 1441 ataacccgat catcagccag ttcttcccca ccctcctgct ctggtccttc tcggccctgc 1501 tcccctccat tgtctactac tctacactgc tggagtctca ctggaccaag tcgggggaaa 1561 accagatcat gatgaccaaa gtctacatat tcttgatctt catggtgctg atcctgccct 1621 ccctgggtct caccagtcta gattttttct tccggtggct ctttgacaaa acttcctcgg 1681 aggcctccat caggttggag tgcgtcttcc tgcctgacca gggtgccttc tttgtgaact 1741 atgtcatcgc ctcggccttc atcggcaatg gcatggagct gctgcggctg ccaggtctca 1801 tcctctatac cttccgcatg atcatggcca agacggctgc tgaccgcagg aatgtcaagc 1861 agaaccaggc cttccagtac gagtttggag ccatgtatgc atggatgctg tgtgtcttca 1921 ctgtcatcgt ggcctacagc atcacttgtc ccatcatcgc gccatttggc ctcatctaca 1981 tcctgctcaa gcacatggtg gaccggcaca acctctactt cgtctacctc ccagccaagc 2041 tggagaaggg gatccacttt gccgctgtga accaggcctt ggcagccccc atcctgtgcc 2101 tcttctggct ctacttcttt tccTTCCTGC GCCTGGGTAT GAAGGCCCCC GCCACTCTGT 2161 TCACCTTCCT GGTGCTGCTG CTCACCATCC TGGTCTGCCT GGCTCACACC TGCTTTGGAT 2221 GCTTCAAGCA CCTCAGCCCT CTGAACTACA AAACAGAAGA GCCTGCAAGT GACAAAGGAA 2281 GTGAGGCAGA GGCCCACATG CCCCCACCGT TCACACCCTA CGTGCCTCGG ATTCTGAACG 2341 GCTTGGCCTC GGAGAGGACA GCACTGTCTC CGCAGCAGCA GCAGCAGCAG ACCTATGGTG 2401 CCATCCACAA CATCAGCGGG ACTATCCCTG GACAGTGCTT GGCGCAGAGC GCCACGGGCA 2461 GTGTGGCTGC TGCCCCCCAG GAGGCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 2521 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2581 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCCTAGCC 2641 AGCCTCGAGA GCTGGGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2701 aagatt