Transcript: Mouse XM_006496816.3

PREDICTED: Mus musculus WD repeat domain 26 (Wdr26), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr26 (226757)
Length:
2639
CDS:
542..2446

Additional Resources:

NCBI RefSeq record:
XM_006496816.3
NBCI Gene record:
Wdr26 (226757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339108 TGCGTATGGTGTCTCTTATAT pLKO_005 1681 CDS 100% 15.000 21.000 N Wdr26 n/a
2 TRCN0000197893 GTTACACTCAACAGATACTTA pLKO.1 1515 CDS 100% 5.625 7.875 N Wdr26 n/a
3 TRCN0000139717 CAAAGGGATCGGTGCCTATAT pLKO.1 1415 CDS 100% 13.200 10.560 N WDR26 n/a
4 TRCN0000339107 CAAAGGGATCGGTGCCTATAT pLKO_005 1415 CDS 100% 13.200 10.560 N Wdr26 n/a
5 TRCN0000339172 GCGAACTGACGCCGTTGAAAT pLKO_005 1194 CDS 100% 13.200 10.560 N Wdr26 n/a
6 TRCN0000144564 GTGCCTATATCACAATACCAA pLKO.1 1426 CDS 100% 3.000 2.400 N WDR26 n/a
7 TRCN0000143778 GCACTAAACTAGCAACAGGAT pLKO.1 1581 CDS 100% 2.640 2.112 N WDR26 n/a
8 TRCN0000197844 GACAAGCTTCAGACCTATTTA pLKO.1 1331 CDS 100% 15.000 10.500 N Wdr26 n/a
9 TRCN0000177046 GTACAGGAAGATCATCCTATT pLKO.1 2048 CDS 100% 10.800 7.560 N Wdr26 n/a
10 TRCN0000143268 GAGGCCATAATGAAGACTTCA pLKO.1 2217 CDS 100% 4.950 3.465 N WDR26 n/a
11 TRCN0000178116 GCCAATCTCATGAAGACAGTT pLKO.1 1806 CDS 100% 4.950 3.465 N Wdr26 n/a
12 TRCN0000177411 GCTTTGTTAAATGTAGCAACT pLKO.1 2102 CDS 100% 4.050 2.835 N Wdr26 n/a
13 TRCN0000339168 GCTTTGTTAAATGTAGCAACT pLKO_005 2102 CDS 100% 4.050 2.835 N Wdr26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.