Transcript: Mouse XM_006496842.3

PREDICTED: Mus musculus zinc finger and BTB domain containing 37 (Zbtb37), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb37 (240869)
Length:
1174
CDS:
163..1095

Additional Resources:

NCBI RefSeq record:
XM_006496842.3
NBCI Gene record:
Zbtb37 (240869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138252 CGGGATCACATGTCCTTGAAT pLKO.1 340 CDS 100% 5.625 4.500 N ZBTB37 n/a
2 TRCN0000418792 TCTGTTACACAGGGCGGATAT pLKO_005 425 CDS 100% 10.800 7.560 N ZBTB37 n/a
3 TRCN0000099524 GCAACTTCTTTCTTTCTGTTA pLKO.1 411 CDS 100% 4.950 3.465 N Zbtb37 n/a
4 TRCN0000099521 GCTCTGTGATATTGTGGTCAA pLKO.1 258 CDS 100% 4.050 2.835 N Zbtb37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04403 pDONR223 100% 77.9% 80.7% None (many diffs) n/a
2 ccsbBroad304_04403 pLX_304 0% 77.9% 80.7% V5 (many diffs) n/a
3 TRCN0000474611 GCAAAGCGCCCATACATGCATAAC pLX_317 46.9% 77.9% 80.7% V5 (many diffs) n/a
Download CSV