Construct: ORF TRCN0000474611
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001287.1_s317c1
- Derived from:
- ccsbBroadEn_04403
- DNA Barcode:
- GCAAAGCGCCCATACATGCATAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZBTB37 (84614)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474611
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | NM_032522.5 | 100% | 100% | |
| 2 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | NM_001346115.2 | 85.2% | 85.3% | 924_924delGins160 |
| 3 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | NM_001369846.1 | 85.2% | 85.3% | 924_924delGins160 |
| 4 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_011510062.3 | 85.2% | 85.3% | 924_924delGins160 |
| 5 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_017002557.2 | 85.2% | 85.3% | 924_924delGins160 |
| 6 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_017002558.1 | 85.2% | 85.3% | 924_924delGins160 |
| 7 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | NM_001122770.3 | 69.3% | 67.7% | (many diffs) |
| 8 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_006711578.4 | 69.3% | 67.7% | (many diffs) |
| 9 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_017002556.2 | 69.3% | 67.7% | (many diffs) |
| 10 | human | 84614 | ZBTB37 | zinc finger and BTB domain ... | XM_024450302.1 | 69.3% | 67.7% | (many diffs) |
| 11 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_006496841.3 | 81.5% | 81.9% | (many diffs) |
| 12 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_006496842.3 | 77.9% | 80.7% | (many diffs) |
| 13 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | NM_173424.3 | 65.3% | 64.1% | (many diffs) |
| 14 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_006496838.2 | 65.3% | 64.1% | (many diffs) |
| 15 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238811.1 | 65.3% | 64.1% | (many diffs) |
| 16 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238812.1 | 65.3% | 64.1% | (many diffs) |
| 17 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238813.1 | 65.3% | 64.1% | (many diffs) |
| 18 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238814.2 | 65.3% | 64.1% | (many diffs) |
| 19 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238815.1 | 65.3% | 64.1% | (many diffs) |
| 20 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238816.2 | 65.3% | 64.1% | (many diffs) |
| 21 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238817.2 | 65.3% | 64.1% | (many diffs) |
| 22 | mouse | 240869 | Zbtb37 | zinc finger and BTB domain ... | XM_011238818.2 | 65.3% | 64.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1149
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaaaggtggg aacatacaat tggagattcc tgacttcagc aactctgtcc 121 tgagccatct aaaccagttg cgcatgcagg gccgtctctg tgatattgtg gtcaatgtgc 181 aaggacaagc ttttcgggct cacaaagtgg tgctggctgc cagctccccc tatttccggg 241 atcacatgtc cttgaatgag atgagtacag tctccatttc agtcatcaag aaccctactg 301 tttttgaaca gctcctttct ttctgttaca cagggcggat atgcctgcaa ctggcagata 361 tcatcagcta cctaacagct gccagttttc tgcaaatgca gcatattata gacaaatgta 421 cacagatcct ggagggcatt catttcaaaa ttaatgtggc tgaggttgaa gcagaattaa 481 gtcaaacaag gacaaagcat caagagagac ctccagagtc tcacagggtt acaccaaatc 541 tcaaccgctc ccttagccca cgacataata ccccaaaggg aaaccggcga ggtcaggtta 601 gtgctgtgct ggatatcaga gagctaagtc ctcctgagga gTCCACCAGC CCTCAGATCA 661 TTGAACCAAG TTCTGATGTA GAGAGCCGGG AGCCCATTCT TCGGATCAAC CGAGCAGGAC 721 AGTGGTATGT GGAGACAGGA GTGGCGGACC GTGGGGGTCG GAGTGATGAT GAAGTTAGAG 781 TTCTTGGAGC AGTACACATC AAAACTGAAA ATCTGGAGGA GTGGCTTGGG CCTGAGAATC 841 AGCCTTCTGG AGAAGATGGG AGTAGTGCAG AGGAAGTAAC AGCCATGGTG ATTGATACCA 901 CAGGCCATGG TTCTGTAGGA CAGGAAAATT ATACTTTAGG GTCTTCAGGA GCCAAGGTGG 961 CTCGGCCAAC AAGCAGTGAA GTTGACAGAT TTAGCCCCTC CGGCAGTGTT GTTCCCTTGA 1021 CAGAGAGACA CAGAGCCAGA AGTGAGTCTC CTGGGAGAAT GGATGAGCCT AAGCAACCCA 1081 GCTCCCAGGT ATGGAGTTGT GGATTTAGAA CTGCTTTGGT GGTTGGAGGA ATTGCTACTG 1141 TGTATGAATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1201 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1261 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCAAAG CGCCCATACA TGCATAACAC 1321 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt