Transcript: Mouse XM_006496898.3

PREDICTED: Mus musculus phospholipase D family, member 5 (Pld5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pld5 (319455)
Length:
2755
CDS:
107..1228

Additional Resources:

NCBI RefSeq record:
XM_006496898.3
NBCI Gene record:
Pld5 (319455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246416 GGCAGCTTACATCGGAAATTT pLKO_005 958 CDS 100% 15.000 21.000 N Pld5 n/a
2 TRCN0000257525 ACCGCAGATTCAAAGGTATTA pLKO_005 185 CDS 100% 13.200 18.480 N Pld5 n/a
3 TRCN0000246414 TCTCGTCTCTTAAAGCTATTT pLKO_005 804 CDS 100% 13.200 18.480 N Pld5 n/a
4 TRCN0000246415 TTCGCTTTATATAGCTCATTA pLKO_005 416 CDS 100% 13.200 18.480 N Pld5 n/a
5 TRCN0000051789 GCCTGGTCCTAGATTTACAAA pLKO.1 390 CDS 100% 5.625 7.875 N PLD5 n/a
6 TRCN0000246417 CTGTCATGGTAGGCGATATTT pLKO_005 2575 3UTR 100% 15.000 10.500 N Pld5 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1960 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13381 pDONR223 100% 73.7% 77.3% None (many diffs) n/a
2 ccsbBroad304_13381 pLX_304 0% 73.7% 77.3% V5 (many diffs) n/a
3 TRCN0000467753 ACCCAGAAAACGTTTTATAAAGAT pLX_317 31.8% 73.7% 77.3% V5 (many diffs) n/a
Download CSV