Transcript: Mouse XM_006497531.3

PREDICTED: Mus musculus plexin domain containing 2 (Plxdc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Plxdc2 (67448)
Length:
12798
CDS:
1387..2973

Additional Resources:

NCBI RefSeq record:
XM_006497531.3
NBCI Gene record:
Plxdc2 (67448)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424193 AGTGAATCTGTCCTTCGATTT pLKO_005 1860 CDS 100% 10.800 15.120 N PLXDC2 n/a
2 TRCN0000181096 CTGGACACCATACCAATGATT pLKO.1 1481 CDS 100% 5.625 7.875 N Plxdc2 n/a
3 TRCN0000180626 GCGCATCATCTTTGGATACAA pLKO.1 2145 CDS 100% 5.625 7.875 N Plxdc2 n/a
4 TRCN0000196114 GACACGAAGATAGCCCTACAT pLKO.1 2659 CDS 100% 4.950 6.930 N Plxdc2 n/a
5 TRCN0000216256 CTCATCTTGGTCCTCATTATA pLKO.1 2764 CDS 100% 15.000 10.500 N Plxdc2 n/a
6 TRCN0000215629 GTTCGAAGAAGAACAATTTAT pLKO.1 2272 CDS 100% 15.000 10.500 N Plxdc2 n/a
7 TRCN0000427746 GTTCGAAGAAGAACAATTTAT pLKO_005 2272 CDS 100% 15.000 10.500 N PLXDC2 n/a
8 TRCN0000217641 GTACTGGCTTACAGGTGTTAA pLKO.1 2997 3UTR 100% 13.200 9.240 N Plxdc2 n/a
9 TRCN0000180105 CAGGACAATAACACCCAGATA pLKO.1 1687 CDS 100% 4.950 3.465 N Plxdc2 n/a
10 TRCN0000184249 GCATACAACCACAGGTGGAAA pLKO.1 1564 CDS 100% 4.950 3.465 N Plxdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12876 pDONR223 100% 78.8% 82.7% None (many diffs) n/a
2 ccsbBroad304_12876 pLX_304 0% 78.8% 82.7% V5 (many diffs) n/a
3 TRCN0000481191 TTGCGCTGCGACAGTTGATCTCAC pLX_317 33% 78.8% 82.7% V5 (many diffs) n/a
Download CSV