Transcript: Mouse XM_006497744.3

PREDICTED: Mus musculus LIM homeobox protein 6 (Lhx6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhx6 (16874)
Length:
3357
CDS:
161..1252

Additional Resources:

NCBI RefSeq record:
XM_006497744.3
NBCI Gene record:
Lhx6 (16874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497744.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432879 GTGCTTTGCCGCATCCATTAC pLKO_005 695 CDS 100% 10.800 15.120 N Lhx6 n/a
2 TRCN0000434673 GTATCTGCTCAAGGTCAACAA pLKO_005 400 CDS 100% 4.950 6.930 N Lhx6 n/a
3 TRCN0000431921 TACATTGAGAGTCAGGTACAG pLKO_005 1118 CDS 100% 4.050 5.670 N LHX6 n/a
4 TRCN0000017141 GCAGGTTATGCAGGCGCAGTT pLKO.1 853 CDS 100% 1.350 1.890 N LHX6 n/a
5 TRCN0000070572 CGACATCCACTACTCTCCGTT pLKO.1 1057 CDS 100% 2.640 2.112 N Lhx6 n/a
6 TRCN0000070571 CCTGGCATGTTTCGCCTGCTT pLKO.1 619 CDS 100% 0.880 0.704 N Lhx6 n/a
7 TRCN0000414535 AGCCTGTCTTTCCTCATTAAC pLKO_005 1514 3UTR 100% 13.200 9.240 N Lhx6 n/a
8 TRCN0000070569 CGCAGAGCAATTGCAGGTTAT pLKO.1 841 CDS 100% 10.800 7.560 N Lhx6 n/a
9 TRCN0000070570 CTACTGCAAGATGGACTACTT pLKO.1 511 CDS 100% 4.950 3.465 N Lhx6 n/a
10 TRCN0000017140 GATGGACTACTTCAGCCGATT pLKO.1 520 CDS 100% 4.050 2.835 N LHX6 n/a
11 TRCN0000070568 GCAAGAATATCTGCTCCAGTT pLKO.1 357 CDS 100% 4.050 2.835 N Lhx6 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3156 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497744.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11825 pDONR223 100% 92.2% 98.3% None (many diffs) n/a
2 ccsbBroad304_11825 pLX_304 0% 92.2% 98.3% V5 (many diffs) n/a
3 TRCN0000466117 CGATGCGGTCTTCATCTAAGGATC pLX_317 29.4% 92.2% 98.3% V5 (many diffs) n/a
Download CSV