Transcript: Mouse XM_006497789.3

PREDICTED: Mus musculus sarcosine dehydrogenase (Sardh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sardh (192166)
Length:
3061
CDS:
163..2922

Additional Resources:

NCBI RefSeq record:
XM_006497789.3
NBCI Gene record:
Sardh (192166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041409 CGATGAGTACACCTTCGACTT pLKO.1 1794 CDS 100% 4.050 5.670 N Sardh n/a
2 TRCN0000041412 GCAAGGCCTATGGTATAGAAT pLKO.1 680 CDS 100% 5.625 4.500 N Sardh n/a
3 TRCN0000041408 GCAGAGACCAAGAGTCTATAT pLKO.1 718 CDS 100% 13.200 9.240 N Sardh n/a
4 TRCN0000041411 CGGAGAGCTGACTTTGGATTT pLKO.1 2722 CDS 100% 10.800 7.560 N Sardh n/a
5 TRCN0000041410 CACCGAGAAGAGTGTTCCTTA pLKO.1 267 CDS 100% 4.950 3.465 N Sardh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06104 pDONR223 100% 84.9% 88.4% None (many diffs) n/a
2 ccsbBroad304_06104 pLX_304 0% 84.9% 88.4% V5 (many diffs) n/a
3 TRCN0000475878 ATGTTTCTAACCAGAGTCAGCAGC pLX_317 12.6% 84.9% 88.4% V5 (many diffs) n/a
Download CSV