Transcript: Mouse XM_006497810.2

PREDICTED: Mus musculus spectrin alpha, non-erythrocytic 1 (Sptan1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sptan1 (20740)
Length:
8022
CDS:
150..7667

Additional Resources:

NCBI RefSeq record:
XM_006497810.2
NBCI Gene record:
Sptan1 (20740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089755 GCAGCAACAATTTAATCGAAA pLKO.1 2222 CDS 100% 4.950 6.930 N Sptan1 n/a
2 TRCN0000090594 GCTAGTCACTATGCCTCAGAT pLKO.1 1473 CDS 100% 4.950 6.930 N Sptan1 n/a
3 TRCN0000090595 GCCACCGATGAAGCTTATAAA pLKO.1 1971 CDS 100% 15.000 10.500 N Sptan1 n/a
4 TRCN0000089753 CCAGTCACAATCACCAATGTT pLKO.1 7865 3UTR 100% 5.625 3.938 N Sptan1 n/a
5 TRCN0000090593 GCATCTGATGAGAACTACAAA pLKO.1 384 CDS 100% 5.625 3.938 N Sptan1 n/a
6 TRCN0000089757 GCACACGAAGTACAGAGGTTT pLKO.1 3879 CDS 100% 4.950 3.465 N Sptan1 n/a
7 TRCN0000089756 GCATCCACTAACAGAGGCAAA pLKO.1 2607 CDS 100% 4.050 2.835 N Sptan1 n/a
8 TRCN0000090596 GCACTTTGCATCTGAAACCAT pLKO.1 524 CDS 100% 3.000 2.100 N Sptan1 n/a
9 TRCN0000090597 GCTGAAGTACAGGCTAACTCA pLKO.1 453 CDS 100% 3.000 2.100 N Sptan1 n/a
10 TRCN0000053671 GACCTCATTAAGAAGAACAAT pLKO.1 5988 CDS 100% 5.625 3.375 N SPTAN1 n/a
11 TRCN0000089754 CCTGCAAGAATACATGGCTTT pLKO.1 7409 CDS 100% 4.050 2.430 N Sptan1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.