Transcript: Mouse XM_006497975.2

PREDICTED: Mus musculus mitogen-activated protein kinase associated protein 1 (Mapkap1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mapkap1 (227743)
Length:
3058
CDS:
89..1657

Additional Resources:

NCBI RefSeq record:
XM_006497975.2
NBCI Gene record:
Mapkap1 (227743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077481 CCCAGTCTGTTGATATTACAT pLKO.1 288 CDS 100% 5.625 3.938 N Mapkap1 n/a
2 TRCN0000301431 CCCAGTCTGTTGATATTACAT pLKO_005 288 CDS 100% 5.625 3.938 N Mapkap1 n/a
3 TRCN0000077478 CCCATATTGAACAGGCAGATT pLKO.1 2094 3UTR 100% 4.950 3.465 N Mapkap1 n/a
4 TRCN0000301432 CCCATATTGAACAGGCAGATT pLKO_005 2094 3UTR 100% 4.950 3.465 N Mapkap1 n/a
5 TRCN0000222761 GAGCTGATTATCTTGCTCAAA pLKO.1 1569 CDS 100% 4.950 3.465 N Mapkap1 n/a
6 TRCN0000301433 GAGCTGATTATCTTGCTCAAA pLKO_005 1569 CDS 100% 4.950 3.465 N Mapkap1 n/a
7 TRCN0000077480 GCCCATTCATAAGTTTGGCTT pLKO.1 844 CDS 100% 2.640 1.848 N Mapkap1 n/a
8 TRCN0000301443 GCCCATTCATAAGTTTGGCTT pLKO_005 844 CDS 100% 2.640 1.848 N Mapkap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14258 pDONR223 100% 86.2% .5% None (many diffs) n/a
2 ccsbBroad304_14258 pLX_304 0% 86.2% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000465275 CTGGCGAGGCTTCTGCTGCCTTGG pLX_317 8.1% 86.2% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV