Transcript: Mouse XM_006498091.2

PREDICTED: Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (Galnt13), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Galnt13 (271786)
Length:
7615
CDS:
597..2267

Additional Resources:

NCBI RefSeq record:
XM_006498091.2
NBCI Gene record:
Galnt13 (271786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093785 GCCCGATCATTGATGTTATTA pLKO.1 1297 CDS 100% 15.000 21.000 N Galnt13 n/a
2 TRCN0000093784 CCCAAGATGTGAAAGTCTCTA pLKO.1 2281 3UTR 100% 4.950 6.930 N Galnt13 n/a
3 TRCN0000093787 GCTAACAGTAACCAATGTCTT pLKO.1 2145 CDS 100% 4.950 6.930 N Galnt13 n/a
4 TRCN0000035398 CCAGGTGTTGTCAAAGTGGAT pLKO.1 1749 CDS 100% 2.640 3.696 N GALNT13 n/a
5 TRCN0000093786 CCTGTACTTCAGCGAGTGTAA pLKO.1 671 CDS 100% 4.950 3.960 N Galnt13 n/a
6 TRCN0000431079 CTCTTGTCACAGGGTTATTTG pLKO_005 2553 3UTR 100% 13.200 9.240 N Galnt13 n/a
7 TRCN0000427898 GACCAATCAATGCTTAGATAA pLKO_005 1907 CDS 100% 13.200 9.240 N Galnt13 n/a
8 TRCN0000417381 TTACGATGCAGGAATGGATAT pLKO_005 1517 CDS 100% 10.800 7.560 N GALNT13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13039 pDONR223 100% 87.1% 91.4% None (many diffs) n/a
2 ccsbBroad304_13039 pLX_304 0% 87.1% 91.4% V5 (many diffs) n/a
Download CSV