Transcript: Mouse XM_006498207.3

PREDICTED: Mus musculus dolichyl pyrophosphate phosphatase 1 (Dolpp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dolpp1 (57170)
Length:
2157
CDS:
386..808

Additional Resources:

NCBI RefSeq record:
XM_006498207.3
NBCI Gene record:
Dolpp1 (57170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339781 TAGCGGAATGCGCACTATTTA pLKO_005 1151 3UTR 100% 15.000 21.000 N Dolpp1 n/a
2 TRCN0000339853 ACCTGAGCCTCAGCCCTATTT pLKO_005 280 5UTR 100% 13.200 9.240 N Dolpp1 n/a
3 TRCN0000339855 CATACAGCAGTGGGCACTAAG pLKO_005 359 5UTR 100% 10.800 7.560 N Dolpp1 n/a
4 TRCN0000126258 GTTCATCATCACGCAGGAAAT pLKO.1 628 CDS 100% 10.800 7.560 N Dolpp1 n/a
5 TRCN0000296831 GTATTTAAGAATGCACCAAAC pLKO_005 445 CDS 100% 6.000 4.200 N DOLPP1 n/a
6 TRCN0000126254 CCAAGCGTTTACAGCTCCTTT pLKO.1 1552 3UTR 100% 4.950 3.465 N Dolpp1 n/a
7 TRCN0000126256 CTCTGGTTTGAGTACACAGTA pLKO.1 734 CDS 100% 4.950 3.465 N Dolpp1 n/a
8 TRCN0000126257 CCAAACAAATAACGCCAGGTT pLKO.1 460 CDS 100% 2.640 1.848 N Dolpp1 n/a
9 TRCN0000126255 GCGGCCTTTCTCGTCTCCTAT pLKO.1 527 CDS 100% 1.650 1.155 N Dolpp1 n/a
10 TRCN0000339780 TCCTTCCTCTTCCTGTATTTA pLKO_005 431 CDS 100% 15.000 9.000 N Dolpp1 n/a
11 TRCN0000296761 ACCCTCACCCACGTCGAATAT pLKO_005 225 5UTR 100% 13.200 10.560 N DOLPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12333 pDONR223 100% 62.6% 67.1% None (many diffs) n/a
2 ccsbBroad304_12333 pLX_304 0% 62.6% 67.1% V5 (many diffs) n/a
3 TRCN0000470919 CCCGTATCAGGGCTCCAAGGAGGA pLX_317 100% 62.6% 67.1% V5 (many diffs) n/a
Download CSV