Transcript: Mouse XM_006498527.3

PREDICTED: Mus musculus sorting nexin family member 21 (Snx21), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx21 (101113)
Length:
2228
CDS:
240..1358

Additional Resources:

NCBI RefSeq record:
XM_006498527.3
NBCI Gene record:
Snx21 (101113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381188 AGTCTCGGAACACCCTAGTTC pLKO_005 571 CDS 100% 4.950 6.930 N Snx21 n/a
2 TRCN0000381727 TCTCGCCGATACTCGGACTTT pLKO_005 741 CDS 100% 4.950 6.930 N Snx21 n/a
3 TRCN0000346799 CCTCACCTGCACTGGTCTTTA pLKO_005 983 CDS 100% 13.200 9.240 N Snx21 n/a
4 TRCN0000346862 TCAAAGAGGTGCTGGACTAAT pLKO_005 1339 CDS 100% 13.200 9.240 N Snx21 n/a
5 TRCN0000363879 CAGAAACCTGCAGCGGCAATT pLKO_005 773 CDS 100% 10.800 7.560 N Snx21 n/a
6 TRCN0000346861 CTATTGAGTAGTTCCAGAAAG pLKO_005 1442 3UTR 100% 10.800 7.560 N Snx21 n/a
7 TRCN0000380558 ATCCTTTCCTGGCACCCTTTC pLKO_005 1192 CDS 100% 6.000 4.200 N Snx21 n/a
8 TRCN0000381194 GAACTTTATTATGCCAGACAG pLKO_005 1483 3UTR 100% 4.050 2.835 N Snx21 n/a
9 TRCN0000190061 GCCAATGTTGTCAAAGACCCT pLKO.1 621 CDS 100% 0.660 0.462 N Snx21 n/a
10 TRCN0000363920 GCCAATGTTGTCAAAGACCCT pLKO_005 621 CDS 100% 0.660 0.462 N Snx21 n/a
11 TRCN0000381786 CCATGTCTGCCATCTCCTTTC pLKO_005 802 CDS 100% 6.000 3.600 N Snx21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09290 pDONR223 100% 43.4% 44.7% None (many diffs) n/a
2 ccsbBroad304_09290 pLX_304 0% 43.4% 44.7% V5 (many diffs) n/a
3 TRCN0000466796 CTTACAATAACTAAGCAGCCCCCG pLX_317 69.2% 43.4% 44.7% V5 (many diffs) n/a
Download CSV