Transcript: Mouse XM_006498677.1

PREDICTED: Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dync1i2 (13427)
Length:
2691
CDS:
251..2149

Additional Resources:

NCBI RefSeq record:
XM_006498677.1
NBCI Gene record:
Dync1i2 (13427)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091916 GCCGAACACTCGCAGAAATTA pLKO.1 2076 CDS 100% 15.000 21.000 N Dync1i2 n/a
2 TRCN0000317171 GCCGAACACTCGCAGAAATTA pLKO_005 2076 CDS 100% 15.000 21.000 N Dync1i2 n/a
3 TRCN0000091913 GCTTCTGATTAAATGAGTGTT pLKO.1 2218 3UTR 100% 4.950 6.930 N Dync1i2 n/a
4 TRCN0000091917 CGTTGGTCAAAGCATCGAGTT pLKO.1 1055 CDS 100% 4.050 5.670 N Dync1i2 n/a
5 TRCN0000091914 GCTGTCATTAAATCGACAGTT pLKO.1 1024 CDS 100% 0.495 0.693 N Dync1i2 n/a
6 TRCN0000091915 CGTGTGGAATATGAAGTACAA pLKO.1 1174 CDS 100% 4.950 3.960 N Dync1i2 n/a
7 TRCN0000313610 ACTTGTGGCTTCCTATAATAA pLKO_005 1114 CDS 100% 15.000 10.500 N Dync1i2 n/a
8 TRCN0000313566 ATGGATAATCTGGGTTTAATA pLKO_005 2252 3UTR 100% 15.000 10.500 N Dync1i2 n/a
9 TRCN0000296603 TTTGGGACGAGGACCTATTAA pLKO_005 622 CDS 100% 15.000 10.500 N DYNC1I2 n/a
10 TRCN0000349910 AGCATGGAGTTGGTTCATAAA pLKO_005 1493 CDS 100% 13.200 9.240 N Dync1i2 n/a
11 TRCN0000296596 TCTTCAGCTTCACTCAGATTC pLKO_005 598 CDS 100% 10.800 7.560 N DYNC1I2 n/a
12 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 740 CDS 100% 4.950 2.475 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10787 pDONR223 100% 88.7% 94.7% None (many diffs) n/a
2 ccsbBroad304_10787 pLX_304 0% 88.7% 94.7% V5 (many diffs) n/a
3 TRCN0000474323 ATACGTCGTAATTGCCCCCTCTAT pLX_317 26.4% 88.7% 94.7% V5 (many diffs) n/a
Download CSV