Transcript: Mouse XM_006498888.2

PREDICTED: Mus musculus nuclear receptor coactivator 3 (Ncoa3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncoa3 (17979)
Length:
5245
CDS:
222..4430

Additional Resources:

NCBI RefSeq record:
XM_006498888.2
NBCI Gene record:
Ncoa3 (17979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095798 ACTGGATAATTCTCCCAATAT pLKO.1 1838 CDS 100% 13.200 9.240 N Ncoa3 n/a
2 TRCN0000095797 GCCGATTACAGTGCCACTTTA pLKO.1 3012 CDS 100% 13.200 9.240 N Ncoa3 n/a
3 TRCN0000095795 CCACAGTTAATGGAGTTTCTT pLKO.1 751 CDS 100% 5.625 3.938 N Ncoa3 n/a
4 TRCN0000095796 CGGCAGGCACTTGAAATGAAA pLKO.1 3816 CDS 100% 5.625 3.938 N Ncoa3 n/a
5 TRCN0000095794 CATTGTCTAAGCATCCAGCTT pLKO.1 4497 3UTR 100% 2.640 1.848 N Ncoa3 n/a
6 TRCN0000157972 CAAGTACATAGAGGAGCTGGA pLKO.1 350 CDS 100% 2.160 1.296 N KANK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13991 pDONR223 100% 80.3% 72.9% None (many diffs) n/a
2 ccsbBroad304_13991 pLX_304 0% 80.3% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479279 CCGATTGTTCTGTATCCCATCTAA pLX_317 8.6% 80.3% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV