Transcript: Mouse XM_006499018.1

PREDICTED: Mus musculus retinoblastoma-like 1 (p107) (Rbl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbl1 (19650)
Length:
3854
CDS:
307..2241

Additional Resources:

NCBI RefSeq record:
XM_006499018.1
NBCI Gene record:
Rbl1 (19650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234086 CTTACTGGACGGCGGTATTTA pLKO_005 160 5UTR 100% 15.000 21.000 N Rbl1 n/a
2 TRCN0000257257 CCGTACTTTCCCGTGGATTAT pLKO_005 597 CDS 100% 13.200 18.480 N Rbl1 n/a
3 TRCN0000040019 CCAAGCTAATAGTCACGTATA pLKO.1 1662 CDS 100% 10.800 15.120 N RBL1 n/a
4 TRCN0000088107 GCCCTGATTTAATGAAAGATA pLKO.1 1538 CDS 100% 5.625 7.875 N Rbl1 n/a
5 TRCN0000234088 ATATCCAGTGCTGGCTAATTT pLKO_005 3479 3UTR 100% 15.000 10.500 N Rbl1 n/a
6 TRCN0000375931 GAGTTTGGCTTGGACTAATAA pLKO_005 741 CDS 100% 15.000 10.500 N Rbl1 n/a
7 TRCN0000234087 TATCCAATCAGGACCATATAA pLKO_005 1886 CDS 100% 15.000 10.500 N Rbl1 n/a
8 TRCN0000375930 ACACACTGATGGATAAGATTA pLKO_005 1052 CDS 100% 13.200 9.240 N Rbl1 n/a
9 TRCN0000088103 GCTTGATGTTATCACCCTATA pLKO.1 2770 3UTR 100% 10.800 7.560 N Rbl1 n/a
10 TRCN0000376002 TGCAACCATTGTCTCCGATTT pLKO_005 956 CDS 100% 10.800 7.560 N Rbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13940 pDONR223 100% 48.1% 1.8% None (many diffs) n/a
2 ccsbBroad304_13940 pLX_304 0% 48.1% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478961 GAAAGCGCCTCCCTATTTAAGAGC pLX_317 13.2% 48.1% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV