Transcript: Mouse XM_006499306.3

PREDICTED: Mus musculus proteasome (prosome, macropain) inhibitor subunit 1 (Psmf1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psmf1 (228769)
Length:
2907
CDS:
182..1018

Additional Resources:

NCBI RefSeq record:
XM_006499306.3
NBCI Gene record:
Psmf1 (228769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499306.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066613 CCCTGAACTTAGATGATTATA pLKO.1 516 CDS 100% 15.000 10.500 N Psmf1 n/a
2 TRCN0000335503 CCCTGAACTTAGATGATTATA pLKO_005 516 CDS 100% 15.000 10.500 N Psmf1 n/a
3 TRCN0000066617 GCAGACTTGACCCTGAACTTA pLKO.1 506 CDS 100% 5.625 3.938 N Psmf1 n/a
4 TRCN0000325579 GCAGACTTGACCCTGAACTTA pLKO_005 506 CDS 100% 5.625 3.938 N Psmf1 n/a
5 TRCN0000066616 GTGGTGACAAACGGCTACTAT pLKO.1 290 CDS 100% 5.625 3.938 N Psmf1 n/a
6 TRCN0000325582 GTGGTGACAAACGGCTACTAT pLKO_005 290 CDS 100% 5.625 3.938 N Psmf1 n/a
7 TRCN0000066614 CCCAGTGATAAGAAATCAGAA pLKO.1 338 CDS 100% 4.950 3.465 N Psmf1 n/a
8 TRCN0000325506 CCCAGTGATAAGAAATCAGAA pLKO_005 338 CDS 100% 4.950 3.465 N Psmf1 n/a
9 TRCN0000066615 CCAGCTAAGTGGAACAGCAAT pLKO.1 365 CDS 100% 4.950 2.970 N Psmf1 n/a
10 TRCN0000325504 CCAGCTAAGTGGAACAGCAAT pLKO_005 365 CDS 100% 4.950 2.970 N Psmf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499306.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07428 pDONR223 100% 84.4% 81.6% None (many diffs) n/a
2 ccsbBroad304_07428 pLX_304 0% 84.4% 81.6% V5 (many diffs) n/a
3 TRCN0000468513 TACATAGCAGATTGTGTGAAATTA pLX_317 41.2% 84.4% 81.6% V5 (many diffs) n/a
Download CSV