Construct: ORF TRCN0000468513
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011578.1_s317c1
- Derived from:
- ccsbBroadEn_07428
- DNA Barcode:
- TACATAGCAGATTGTGTGAAATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PSMF1 (9491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468513
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_006814.5 | 99.8% | 99.6% | 107T>G |
| 2 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_178578.3 | 99.8% | 99.6% | 107T>G |
| 3 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_001323410.2 | 95.1% | 93% | (many diffs) |
| 4 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_001323408.2 | 95.1% | 94.8% | (many diffs) |
| 5 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_001323409.2 | 94.7% | 92.7% | (many diffs) |
| 6 | human | 9491 | PSMF1 | proteasome inhibitor subunit 1 | NM_001323407.2 | 62.9% | 62.7% | (many diffs) |
| 7 | mouse | 228769 | Psmf1 | proteasome (prosome, macrop... | NM_212446.2 | 86.6% | 83.7% | (many diffs) |
| 8 | mouse | 228769 | Psmf1 | proteasome (prosome, macrop... | XM_006499306.3 | 84.4% | 81.6% | (many diffs) |
| 9 | mouse | 228769 | Psmf1 | proteasome (prosome, macrop... | NM_001305244.1 | 50.6% | 48.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 882
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgggcctg gaggtactgt tcgcatcggc agcgccggcc atcacctgca 121 ggcaggacgc gctcgtctgc ttcttgcatt gggaagtggt gacacacggt tactgcggct 181 tgggtgtcgg tgaccagccg ggtcccaatg ataagaagtc agaactgctg ccagctgggt 241 ggaacaacaa taaagacctg tatgtcctcc ggtatgagta taaggatggg tccagaaagc 301 tccttgtgaa agccatcacc gtggagagca gcatgatcct caatgtgctg gaatatggct 361 cacagcaagt ggcagacttg accctgaact tggatgatta tatcgatgca gaacacctgg 421 gtgacttcca caggacctac aagaacagtg aggagcttcg gtctcgtatt gtgtctggaa 481 tcatcacacc tatccatgag cagtgggaaa aggctaatgt aagcagtccc caccgggagt 541 tccccccTGC TACCGCCAGA GAGGTGGACC CACTCCGGAT TCCTCCACAC CACCCACACA 601 CCAGTCGGCA GCCTCCCTGG TGTGATCCCC TGGGCCCGTT TGTTGTCGGG GGAGAAGACT 661 TAGACCCTTT TGGGCCTCGG AGAGGTGGCA TGATTGTGGA TCCCCTGAGA TCTGGCTTCC 721 CAAGAGCACT TATTGACCCT TCCTCAGGCC TCCCGAACCG ACTTCCTCCA GGCGCTGTGC 781 CCCCAGGAGC TCGCTTTGAC CCCTTTGGAC CCATTGGGAC CAGCCCACCC GGACCTAACC 841 CAGACCATCT CCCCCCGCCG GGCTACGATG ACATGTACCT GTTGCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGATAC ATAGCAGATT GTGTGAAATT AACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t