Transcript: Mouse XM_006499369.3

PREDICTED: Mus musculus nuclear receptor coactivator 5 (Ncoa5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncoa5 (228869)
Length:
3201
CDS:
214..1434

Additional Resources:

NCBI RefSeq record:
XM_006499369.3
NBCI Gene record:
Ncoa5 (228869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305020 CACACGAAGGGATCCCTATAG pLKO_005 243 CDS 100% 10.800 15.120 N Ncoa5 n/a
2 TRCN0000305022 TCGGGACTTTCGTGATCTAAG pLKO_005 474 CDS 100% 10.800 15.120 N Ncoa5 n/a
3 TRCN0000126153 CGGTACAGAGATAGCTTTGAT pLKO.1 652 CDS 100% 5.625 4.500 N Ncoa5 n/a
4 TRCN0000308428 CGGTACAGAGATAGCTTTGAT pLKO_005 652 CDS 100% 5.625 4.500 N Ncoa5 n/a
5 TRCN0000126152 CGACGTAGAGAGGAGCTTTAT pLKO.1 736 CDS 100% 13.200 9.240 N Ncoa5 n/a
6 TRCN0000308429 CGACGTAGAGAGGAGCTTTAT pLKO_005 736 CDS 100% 13.200 9.240 N Ncoa5 n/a
7 TRCN0000305021 CGGCTGTTGCTTATCACTTAT pLKO_005 2117 3UTR 100% 13.200 9.240 N Ncoa5 n/a
8 TRCN0000415614 GGATCTTACCAGAGGCATTAC pLKO_005 1953 3UTR 100% 10.800 7.560 N NCOA5 n/a
9 TRCN0000126149 CCCTTGAAGTTGGTTTGGTTT pLKO.1 2522 3UTR 100% 4.950 3.465 N Ncoa5 n/a
10 TRCN0000126150 GCCTGTATCTTCCACAGGTAT pLKO.1 1814 3UTR 100% 0.495 0.347 N Ncoa5 n/a
11 TRCN0000126151 GCCTGTGGATTGCTCAGTTAT pLKO.1 801 CDS 100% 13.200 7.920 N Ncoa5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12401 pDONR223 100% 69.4% 69.9% None (many diffs) n/a
2 ccsbBroad304_12401 pLX_304 0% 69.4% 69.9% V5 (many diffs) n/a
3 TRCN0000465929 CAAGTCACTTTGCCATTGTGTCTT pLX_317 37% 69.4% 69.9% V5 (many diffs) n/a
Download CSV