Transcript: Mouse XM_006499877.2

PREDICTED: Mus musculus Src homology 2 domain containing F (Shf), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Shf (435684)
Length:
1808
CDS:
37..1347

Additional Resources:

NCBI RefSeq record:
XM_006499877.2
NBCI Gene record:
Shf (435684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254685 ATGAAGCTGTCCCGGACTAAG pLKO_005 1183 CDS 100% 10.800 15.120 N Shf n/a
2 TRCN0000265608 CTGAAATCGTGCACCACTATG pLKO_005 1253 CDS 100% 10.800 15.120 N Shf n/a
3 TRCN0000254686 CGCTGAAGATTCCTTAATTTA pLKO_005 1471 3UTR 100% 15.000 10.500 N Shf n/a
4 TRCN0000265610 AGCCGCAAGCTGCCCATTAAG pLKO_005 1276 CDS 100% 4.400 3.080 N Shf n/a
5 TRCN0000182320 GAGTGGAAGAAGGAACGGATT pLKO.1 835 CDS 100% 4.050 2.835 N Shf n/a
6 TRCN0000178289 GAAGAAGGAACGGATTTCCAA pLKO.1 840 CDS 100% 3.000 2.100 N Shf n/a
7 TRCN0000254684 GTGGAAGAAGGAACGGATTTC pLKO_005 837 CDS 100% 10.800 6.480 N Shf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14335 pDONR223 100% 31.2% 11.3% None (many diffs) n/a
2 ccsbBroad304_14335 pLX_304 0% 31.2% 11.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479544 TGCATACGTCCCTATATTCGCGTC pLX_317 44.8% 31.2% 11.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV