Transcript: Mouse XM_006499974.1

PREDICTED: Mus musculus acyl-CoA synthetase short-chain family member 2 (Acss2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acss2 (60525)
Length:
2842
CDS:
317..2176

Additional Resources:

NCBI RefSeq record:
XM_006499974.1
NBCI Gene record:
Acss2 (60525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076125 GATCGAAATGTCCATGAGAAA pLKO.1 356 CDS 100% 4.950 6.930 N Acss2 n/a
2 TRCN0000076124 CGGTTTGAGACCACCTACTTT pLKO.1 1673 CDS 100% 5.625 4.500 N Acss2 n/a
3 TRCN0000076126 GTGTGTCAGTTCAGCAATGTT pLKO.1 464 CDS 100% 5.625 3.938 N Acss2 n/a
4 TRCN0000076123 CCTTAACCAAAGTCAGCTCTT pLKO.1 2403 3UTR 100% 4.050 2.835 N Acss2 n/a
5 TRCN0000076127 CCATGAAACCTGGTTCTGCTT pLKO.1 1518 CDS 100% 2.640 1.848 N Acss2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12288 pDONR223 100% 65.1% 67.8% None (many diffs) n/a
2 ccsbBroad304_12288 pLX_304 0% 65.1% 67.8% V5 (many diffs) n/a
3 TRCN0000471769 ATGACCTACGCTCGGTAGGCACAC pLX_317 34.3% 65.1% 67.8% V5 (many diffs) n/a
Download CSV