Transcript: Mouse XM_006500107.2

PREDICTED: Mus musculus G protein-coupled receptor 155 (Gpr155), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr155 (68526)
Length:
3138
CDS:
707..3097

Additional Resources:

NCBI RefSeq record:
XM_006500107.2
NBCI Gene record:
Gpr155 (68526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253012 CTCAACGCTTGCTGGTGATAT pLKO_005 772 CDS 100% 13.200 18.480 N Gpr155 n/a
2 TRCN0000267473 ATCCACCTTCGATGTCGATAA pLKO_005 837 CDS 100% 10.800 15.120 N Gpr155 n/a
3 TRCN0000226230 ATAGCAGGAAGGGCCAATATC pLKO_005 911 CDS 100% 13.200 10.560 N Gpr155 n/a
4 TRCN0000226232 ACATGGAAGTGGAGATTATAA pLKO_005 1749 CDS 100% 15.000 10.500 N Gpr155 n/a
5 TRCN0000218904 ATGTTTCTGCCTGGTTATTAA pLKO_005 1815 CDS 100% 15.000 10.500 N Gpr155 n/a
6 TRCN0000253013 TACAGAACCCGATAGTATTTA pLKO_005 1383 CDS 100% 15.000 10.500 N Gpr155 n/a
7 TRCN0000226231 TTTGCCCTTCCAGCCTTATTA pLKO_005 977 CDS 100% 15.000 10.500 N Gpr155 n/a
8 TRCN0000267481 AGAGTATCTGCAGTACATTTA pLKO_005 1228 CDS 100% 13.200 9.240 N Gpr155 n/a
9 TRCN0000253011 TGTGTGTGTATTAACCTTATT pLKO_005 1087 CDS 100% 13.200 9.240 N Gpr155 n/a
10 TRCN0000226233 ATATGCTCACAGCGAACTTAC pLKO_005 1974 CDS 100% 10.800 7.560 N Gpr155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489127 TACAGCGATCATGGTAACCACTCC pLX_317 15.4% 75.9% 78.5% V5 (many diffs) n/a
2 TRCN0000492114 GCATGGGCAACCACGCCCGGTAAA pLX_317 15.2% 75.9% 78.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV