Transcript: Mouse XM_006500162.1

PREDICTED: Mus musculus regulation of nuclear pre-mRNA domain containing 1B (Rprd1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rprd1b (70470)
Length:
3721
CDS:
407..1288

Additional Resources:

NCBI RefSeq record:
XM_006500162.1
NBCI Gene record:
Rprd1b (70470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241222 GTCTGTTACTAGCGGAATATA pLKO_005 1104 CDS 100% 15.000 21.000 N Rprd1b n/a
2 TRCN0000241221 CTCCGCAAAGCCAAATCAAAT pLKO_005 548 CDS 100% 13.200 18.480 N Rprd1b n/a
3 TRCN0000241223 TCTCTTGACTGAGGAGTTAAT pLKO_005 925 CDS 100% 13.200 18.480 N Rprd1b n/a
4 TRCN0000174988 GCAAAGCCAAATCAAATAGAA pLKO.1 552 CDS 100% 5.625 7.875 N Rprd1b n/a
5 TRCN0000176096 GCCGACATTTCCTGATCTAAA pLKO.1 1969 3UTR 100% 13.200 10.560 N Rprd1b n/a
6 TRCN0000241220 GCCGACATTTCCTGATCTAAA pLKO_005 1969 3UTR 100% 13.200 10.560 N Rprd1b n/a
7 TRCN0000241224 ACCTTTCGCTGTTGCCTAATG pLKO_005 1404 3UTR 100% 10.800 7.560 N Rprd1b n/a
8 TRCN0000174628 GCCAAATCAAATAGAAAGCTT pLKO.1 557 CDS 100% 3.000 2.100 N Rprd1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08778 pDONR223 100% 82.2% 84.6% None (many diffs) n/a
2 ccsbBroad304_08778 pLX_304 0% 82.2% 84.6% V5 (many diffs) n/a
Download CSV