Transcript: Mouse XM_006500313.3

PREDICTED: Mus musculus secernin 3 (Scrn3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scrn3 (74616)
Length:
3434
CDS:
172..1497

Additional Resources:

NCBI RefSeq record:
XM_006500313.3
NBCI Gene record:
Scrn3 (74616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346428 AGTCCAAGGCGTTCGTAATAT pLKO_005 771 CDS 100% 15.000 21.000 N Scrn3 n/a
2 TRCN0000346424 CATAGTATTAGGTGGTATTTC pLKO_005 1579 3UTR 100% 13.200 18.480 N Scrn3 n/a
3 TRCN0000174461 CGACTGATAAACCACAGTAAT pLKO.1 1599 3UTR 100% 13.200 18.480 N Scrn3 n/a
4 TRCN0000216838 GGTCTAGATTTACGCTGTTTG pLKO.1 1787 3UTR 100% 10.800 15.120 N Scrn3 n/a
5 TRCN0000346352 ACGTCTCAAGTGTACTTATAT pLKO_005 390 CDS 100% 15.000 12.000 N Scrn3 n/a
6 TRCN0000346426 ACAGTAGGAAATAGGGTTATT pLKO_005 286 CDS 100% 13.200 9.240 N Scrn3 n/a
7 TRCN0000346427 GATGAAGTACAAGAAGTAATT pLKO_005 334 CDS 100% 13.200 9.240 N Scrn3 n/a
8 TRCN0000216839 GGCAAAGAGTTCAGCTATTAC pLKO.1 676 CDS 100% 13.200 9.240 N Scrn3 n/a
9 TRCN0000174632 GATGTCATTGTTGACTTACTA pLKO.1 622 CDS 100% 5.625 3.938 N Scrn3 n/a
10 TRCN0000174375 CACCAACATTTGAACCTGAAA pLKO.1 1211 CDS 100% 4.950 3.465 N Scrn3 n/a
11 TRCN0000175251 CTCTTTCCTCAATATGTGAAA pLKO.1 1438 CDS 100% 4.950 3.465 N Scrn3 n/a
12 TRCN0000194464 GCATTGGGAATGAGGCTGTAT pLKO.1 506 CDS 100% 4.950 3.465 N Scrn3 n/a
13 TRCN0000175015 GCAGTTCATAATGATTTGGAA pLKO.1 367 CDS 100% 3.000 2.100 N Scrn3 n/a
14 TRCN0000175157 GCAGTATCTGAAGAGATAGAA pLKO.1 1372 CDS 100% 0.563 0.394 N Scrn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12579 pDONR223 100% 78.9% 75.9% None (many diffs) n/a
2 TRCN0000469027 CTATCTAAACTCATGATACTCAAT pLX_317 33.6% 77.1% 75.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV